[{"_id":4,"collapsing_method":null,"collection_time_point_relative":"Week 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278153_filtered_1.fastq -r ERR1278153_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278153.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"35","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278153.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A2wk1","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278153_aa.txz, ERR1278153_ab.txz, ERR1278153_ac.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278153","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 2","igblast_file_name":"ERR1278153.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,463,721","cell_number":"2,369,736","ir_sequence_count":1000000,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":35,"ir_subject_age_max":35,"ir_project_sample_id":4},{"_id":5,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"34","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298742.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"43123_CSF","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298742.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298742","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"43213_CSF","igblast_file_name":"filtered_SRR1298742.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"20873","cell_number":null,"ir_sequence_count":9409,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":34,"ir_subject_age_max":34,"ir_project_sample_id":5},{"_id":10,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"64","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220435.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_8_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220435.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220435","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_8_6-sc-2013-01-11T14:16:57Z-1548384","igblast_file_name":"filtered_ERR220435.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,723","cell_number":"8,455","ir_sequence_count":6464,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":64,"ir_subject_age_max":64,"ir_project_sample_id":10},{"_id":12,"study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"45","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode45a.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"45a","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode45a.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"45","igblast_file_name":" SRR030820_filtered_barcode45a.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,473","cell_number":"422073","ir_sequence_count":4381,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":45,"ir_subject_age_max":45,"ir_project_sample_id":12},{"_id":14,"study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"70","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode70.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"70","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode70.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"70","igblast_file_name":" SRR030820_filtered_barcode70.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,018","cell_number":"422073","ir_sequence_count":8082,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":70,"ir_subject_age_max":70,"ir_project_sample_id":14},{"_id":16,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220399.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_11","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220399.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220399","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_11-sc-2013-01-11T14:16:14Z-1548344","igblast_file_name":"filtered_ERR220399.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"25,546","cell_number":"6,910","ir_sequence_count":6315,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":16},{"_id":19,"collapsing_method":null,"collection_time_point_relative":"one time point Jan 2011","sequencing_facility":null,"cell_phenotype":"CD19+, IgM-, IgD-, IgA-","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"PBMC","collected_by":"P.D. Kwong, J. Zhu, G. Ofek","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"downstream from end of J chain","disease_state_sample":"HIV+","study_id":"PRJNA188191","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_SRR654171heavy_split1.fasta, filtered_SRR654171heavy_split2.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptome","study_group_description":"Case","sample_id":"N152-Heavy Chain2","lab_name":"Kwong Lab","pcr_target_locus":null,"lab_address":"National Institute of Allergy and Infectious Disease-Vaccine Research Center","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR654171heavy_split1.txz, filtered_SRR654171heavy_split2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR654171","template_amount":null,"submitted_by":"P.D. Kwong, J. Zhu, G. Ofek","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"N152","igblast_file_name":"filtered_SRR654171heavy_split1_igblast.fmt7, filtered_SRR654171heavy_split2_igblast.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"755,429","cell_number":"843,084","ir_sequence_count":755429,"forward_PCR_primer_target_location":"Upstream from start of V-gene leader Sequence ","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mining the antibodyome for HIV-1 neutralizing antibodies with next generation sequencing and phylogenetic pairing of heavy\/light chains","pub_ids":null,"disease_diagnosis":"HIV-1 infected for 20 years off antiretroviral treament","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"PBMC","ir_project_sample_id":19},{"_id":17,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode5.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-e","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode5.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030817_filtered_barcode5.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,006","cell_number":"556038","ir_sequence_count":1001,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":17},{"_id":20,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode13.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode13.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL","igblast_file_name":"SRR030809_filtered_barcode13.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9653","cell_number":"251408","ir_sequence_count":9585,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":20},{"_id":21,"study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","lab_name":"Department of Pathology, Stanford University","submitted_by":"Boyd S.D, Marshall E.L ","prior_therapies":null,"cells_per_reaction":null,"read_length":null,"complete_sequences":null,"fasta_file_name":" SRR030822_filtered_barcode37.fasta","ir_sra_run_id":"SRR030822","disease_stage":null,"sample_id":"37","library_generation_kit_version":null,"disease_state_sample":"Healthy","sex":null,"collapsing_method":null,"sequencing_facility":null,"mixcr_file_name":null,"grants":null,"inclusion_exclusion_criteria":null,"disease_length":null,"primer_match_cutoffs":null,"cell_storage":null,"ethnicity":null,"intervention":null,"synthetic":null,"physical_linkage":null,"ancestry_population":null,"collected_by":"Boyd S.D, Marshall E.L ","collection_time_point_relative":"time 0 and time 14 months","subject_id":"37","sequencing_run_id":null,"disease_diagnosis":"Healthy","sample_type":null,"igblast_file_name":" SRR030822_filtered_barcode37.fmt7","single_cell":null,"reverse_PCR_primer_target_location":null,"race":null,"template_class":"DNA","cell_phenotype":null,"total_reads_passing_qc_filter":"3,811","imgt_file_name":" SRR030822_filtered_barcode37.txz","link_type":null,"data_processing_protocols":null,"pub_ids":null,"cell_quality":null,"quality_thresholds":null,"sequencing_kit":null,"template_amount":null,"cell_isolation":null,"collection_time_event":null,"study_description":"Cancer Study","study_group_description":"Control","cell_processing_protocol":null,"sequencing_run_date":null,"forward_PCR_primer_target_location":"J chain and VH chain","pcr_target_locus":null,"biomaterial_provider":null,"immunogen":null,"strain_name":null,"germline_database":null,"medical_history":null,"library_source":"genomic","sequencing_platform":"454 GS FLX","software_versions":null,"linked_subjects":null,"age_event":null,"library_construction_method":"PCR","cell_number":"433784","template_quality":null,"cell_subset":"B cell","tissue":"blood","tissue_processing":null,"study_id":null,"lab_address":"Stanford University","ir_subject_age":"37","paired_read_assembly":null,"anatomic_site":null,"organism":"Homo sapiens","ir_sequence_count":3781,"library_generation_protocol":null,"ir_subject_age_min":37,"ir_subject_age_max":37,"ir_project_sample_id":21},{"_id":27,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"64","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220406.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220406.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220406","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_8-sc-2013-01-11T14:16:23Z-1548351","igblast_file_name":"filtered_ERR220406.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9,969","cell_number":"10,503","ir_sequence_count":8243,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":64,"ir_subject_age_max":64,"ir_project_sample_id":27},{"_id":28,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode1.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-a","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode1.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030816_filtered_barcode1.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"12,179","cell_number":"635307","ir_sequence_count":12147,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":28},{"_id":29,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode2.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-1b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1 time 0 replicate","igblast_file_name":"SRR030815_filtered_barcode2.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,267","cell_number":"171714","ir_sequence_count":4247,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":29},{"_id":31,"collapsing_method":null,"collection_time_point_relative":"one time point Jan 2011","sequencing_facility":null,"cell_phenotype":"CD19+, IgM-, IgD-, IgA-","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"PBMC","collected_by":"P.D. Kwong, J. Zhu, G. Ofek","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"downstream from end of J chain","disease_state_sample":"HIV+","study_id":"PRJNA188191","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR3458041heavy_split1.fasta, filtered_SRR3458041heavy_split2.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"N152-Heavy Chain1","lab_name":"Kwong Lab","pcr_target_locus":null,"lab_address":"National Institute of Allergy and Infectious Disease-Vaccine Research Center","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR3458041heavy_split1.txz, filtered_SRR3458041heavy_split2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR3458041","template_amount":null,"submitted_by":"P.D. Kwong, J. Zhu, G. Ofek","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"N152","igblast_file_name":"filtered_SRR3458041heavy_split1_igblast.fmt7, filtered_SRR3458041heavy_split2_igblast.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"585,083","cell_number":"647,551","ir_sequence_count":585083,"forward_PCR_primer_target_location":"Upstream from start of V-gene leader Sequence ","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mining the antibodyome for HIV-1 neutralizing antibodies with next generation sequencing and phylogenetic pairing of heavy\/light chains","pub_ids":null,"disease_diagnosis":"HIV-1 infected for 20 years off antiretroviral treament","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"PBMC","ir_project_sample_id":31},{"_id":34,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode7.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 2 FL-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode7.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 2 FL","igblast_file_name":"SRR030813_filtered_barcode7.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,198","cell_number":"182564","ir_sequence_count":3188,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"follicular lymphoma","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":34},{"_id":36,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode23.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 1-3b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode23.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 1 time 14 months replicate","igblast_file_name":"SRR030815_filtered_barcode23.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,335","cell_number":"171714","ir_sequence_count":3318,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":36},{"_id":53,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"69","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220430.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_7_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220430.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220430","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_7_7-sc-2013-01-11T14:16:51Z-1548378","igblast_file_name":"filtered_ERR220430.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9,146","cell_number":"5,513","ir_sequence_count":3721,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":69,"ir_subject_age_max":69,"ir_project_sample_id":53},{"_id":42,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"68","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220464.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_5_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220464.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220464","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_5_7-sc-2013-01-11T14:17:29Z-1548416","igblast_file_name":"filtered_ERR220464.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9444","cell_number":"9,080","ir_sequence_count":7622,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":68,"ir_subject_age_max":68,"ir_project_sample_id":42},{"_id":49,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode13.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode13.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL","igblast_file_name":"SRR030815_filtered_barcode13.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,747","cell_number":"171714","ir_sequence_count":4731,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":49},{"_id":47,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode16.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:100-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode16.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:100","igblast_file_name":"SRR030809_filtered_barcode16.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"15489","cell_number":"251408","ir_sequence_count":15363,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":47},{"_id":48,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode2.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-1b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1","igblast_file_name":"SRR030809_filtered_barcode2.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"13291","cell_number":"251408","ir_sequence_count":13141,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":48},{"_id":45,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode17.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:1000-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode17.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:1000","igblast_file_name":"SRR030807_filtered_barcode17.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"11244","cell_number":"270691","ir_sequence_count":11151,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":45},{"_id":41,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode12.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"healthy donor 2-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode12.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"healthy donor 2","igblast_file_name":"SRR030809_filtered_barcode12.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"12016","cell_number":"251408","ir_sequence_count":11911,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":41},{"_id":52,"collapsing_method":null,"collection_time_point_relative":"sampled 4\/23\/2008","sequencing_facility":null,"cell_phenotype":" CD3-, CD14-, CD19+, CD20+, IgG+, IgM-, RSC3+","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":">18 years","organism":"Homo sapiens","tissue":"PBMC","collected_by":"T. Zhu, J. Zhou, P.D. Kwong, ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"C Region","disease_state_sample":"HIV+","study_id":"PRJNA195543","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_SRR800616lambda_split1.fasta, unfiltered_SRR800616lambda_split1.fasta","library_construction_method":"other","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"other","study_group_description":"Case","sample_id":"IAVI 23","lab_name":"Vaccine Research Center","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR800616lambda_split1.txz, unfiltered_SRR800616lambda_split1.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR800616","template_amount":null,"submitted_by":"T. Zhu, J. Zhou, P.D. Kwong, ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"IAVI 23","igblast_file_name":"filtered_SRR800616lambda_split1_igblast.fmt7, unfiltered_SRR800616lambda_split1_igblast.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"261,576","cell_number":"324,668","ir_sequence_count":261576,"forward_PCR_primer_target_location":"V gene specific","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Multi-donor Analysis Reveal Structural Elements, Genetic Determinants, and Maturation Pathway for Effective HIV-1 Neutralization by VRC01-class Antibodies","pub_ids":null,"disease_diagnosis":"HIV-1 infected clade A, off of antiretroviral treatment","ir_subject_age_min":18,"ir_subject_age_max":9999,"ir_project_sample_id":52},{"_id":51,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode25.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 1b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode25.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 0 replicate","igblast_file_name":"SRR030813_filtered_barcode25.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,657","cell_number":"182564","ir_sequence_count":4636,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":51},{"_id":55,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode16.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:100-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode16.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:100","igblast_file_name":"SRR030815_filtered_barcode16.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,306","cell_number":"171714","ir_sequence_count":5270,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":55},{"_id":38,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220410.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_10_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220410.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220410","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_10_5-sc-2013-01-11T14:16:28Z-1548355","igblast_file_name":"filtered_ERR220410.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,647","cell_number":"8,573","ir_sequence_count":5457,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":38},{"_id":43,"collapsing_method":null,"collection_time_point_relative":"Day 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875289_filtered_1.fastq -r ERR875289_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875289.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"13","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875290.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"F1Cpost","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875290_aa.txz, ERR875290_ab.txz, ERR875290_ac.txz, ERR875290_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875290","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 1 Carrier","igblast_file_name":"ERR875290.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":null,"cell_number":"4,401,648","ir_sequence_count":1928616,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg carrier vaccinated","ir_subject_age_min":13,"ir_subject_age_max":13,"ir_project_sample_id":43},{"_id":58,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220413.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_10_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220413.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220413","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_10_8-sc-2013-01-11T14:16:31Z-1548358","igblast_file_name":"filtered_ERR220413.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,584","cell_number":"8,836","ir_sequence_count":6170,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":58},{"_id":59,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"54","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_SRR1297001.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"26712_PBMC","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1297001.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1297001","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"26712_PBMC","igblast_file_name":"filtered_SRR1297001.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,493,227","cell_number":null,"ir_sequence_count":117778,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":54,"ir_subject_age_max":54,"ir_project_sample_id":59},{"_id":60,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220415.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_11_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220415.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220415","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_11_4-sc-2013-01-11T14:16:34Z-1548361","igblast_file_name":"filtered_ERR220415.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,042","cell_number":"5,227","ir_sequence_count":4579,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":60},{"_id":69,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":"IgG+, CD19+, CD20+","paired_read_assembly":null,"ethnicity":"Hispanic","sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"PBMC","collected_by":"T. Zhu, J. Zhou, P.D. Kwong, ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"C Region","disease_state_sample":"HIV+","study_id":"PRJNA195543","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_SRR800642heavyandlight_split1.fasta, filtered_SRR800642heavyandlight_split2.fasta, filtered_SRR800642heavyandlight_split3.fasta, unfiltered_SRR800642heavyandlight_split1.fasta, unfiltered_SRR800642heavyandlight_split2.fasta, unfiltered_SRR800642heavyandlight_split3.fasta","library_construction_method":"other","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"other","study_group_description":"Case","sample_id":"RU 3","lab_name":"Vaccine Research Center","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR800642heavyandlight_split1.txz, filtered_SRR800642heavyandlight_split2.txz, filtered_SRR800642heavyandlight_split3.txz, unfiltered_SRR800642heavyandlight_split1.txz, unfiltered_SRR800642heavyandlight_split2.txz, unfiltered_SRR800642heavyandlight_split3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR800642","template_amount":null,"submitted_by":"T. Zhu, J. Zhou, P.D. Kwong, ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"RU 3","igblast_file_name":null,"intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,277,929","cell_number":"1.4million","ir_sequence_count":1277929,"forward_PCR_primer_target_location":"V gene specific","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Multi-donor Analysis Reveal Structural Elements, Genetic Determinants, and Maturation Pathway for Effective HIV-1 Neutralization by VRC01-class Antibodies","pub_ids":null,"disease_diagnosis":"diagnosed 2002, HIV-1 infected clade B","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":69},{"_id":63,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"22","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298733.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"29612_CSF","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298733.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298733","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"29612_CSF","igblast_file_name":"filtered_SRR1298733.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"20617","cell_number":null,"ir_sequence_count":5625,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":22,"ir_subject_age_max":22,"ir_project_sample_id":63},{"_id":72,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"34","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298735.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"30512_PBMC","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298735.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298735","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"30512_PBMC","igblast_file_name":"filtered_SRR1298735.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"142558","cell_number":null,"ir_sequence_count":175140,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":34,"ir_subject_age_max":34,"ir_project_sample_id":72},{"_id":77,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875304_filtered_1.fastq -r ERR875304_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875304.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"42","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278149.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A1pre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278149_aa.txz, ERR1278149_ab.txz, ERR1278149_ac.txz, ERR1278149_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278149","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 1","igblast_file_name":"ERR1278149.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,617,248","cell_number":"3,207,806","ir_sequence_count":1821655,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":42,"ir_subject_age_max":42,"ir_project_sample_id":77},{"_id":85,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"43","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298738.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"34012_CSF","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298738.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298738","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"34012_CSF","igblast_file_name":"filtered_SRR1298738.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"18009","cell_number":null,"ir_sequence_count":20656,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":43,"ir_subject_age_max":43,"ir_project_sample_id":85},{"_id":81,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode22.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 1-3a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode22.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 1 time 14 months","igblast_file_name":"SRR030813_filtered_barcode22.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,705","cell_number":"182564","ir_sequence_count":4682,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":81},{"_id":82,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode3.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-3a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1","igblast_file_name":"SRR030807_filtered_barcode3.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"12909","cell_number":"270691","ir_sequence_count":12753,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":82},{"_id":87,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode3.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-c","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030817_filtered_barcode3.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,069","cell_number":"556038","ir_sequence_count":3057,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":87},{"_id":86,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode13.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Normal control-a1,3","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode13.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Normal control","igblast_file_name":" SRR030816_filtered_barcode13.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"13,020","cell_number":"635307","ir_sequence_count":12947,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":86},{"_id":90,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"42","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode42.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"42","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode42.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"42","igblast_file_name":" SRR030822_filtered_barcode42.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,482","cell_number":"433784","ir_sequence_count":2854,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":42,"ir_subject_age_max":42,"ir_project_sample_id":90},{"_id":94,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode15.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:10-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode15.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:10","igblast_file_name":"SRR030813_filtered_barcode15.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,371","cell_number":"182564","ir_sequence_count":8338,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":94},{"_id":95,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"64","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220436.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_8_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220436.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220436","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_8_7-sc-2013-01-11T14:16:58Z-1548385","igblast_file_name":"filtered_ERR220436.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,292","cell_number":"9,692","ir_sequence_count":7395,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":64,"ir_subject_age_max":64,"ir_project_sample_id":95},{"_id":93,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"37","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298736.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"31012_CSF","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298736.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298736","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"31012_CSF","igblast_file_name":"filtered_SRR1298736.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5637","cell_number":null,"ir_sequence_count":13686,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":37,"ir_subject_age_max":37,"ir_project_sample_id":93},{"_id":96,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode8.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 3 FL and SLL-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode8.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 3 FL and SLL","igblast_file_name":"SRR030807_filtered_barcode8.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"15431","cell_number":"270691","ir_sequence_count":15359,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"small lymphocytic leukemia, follicular lymphoma","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":96},{"_id":97,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"55","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode55.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"55","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode55.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"55","igblast_file_name":" SRR030822_filtered_barcode55.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,331","cell_number":"433784","ir_sequence_count":5842,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":55,"ir_subject_age_max":55,"ir_project_sample_id":97},{"_id":98,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode13.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode13.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL","igblast_file_name":"SRR030807_filtered_barcode13.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"10347","cell_number":"270691","ir_sequence_count":10275,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":98},{"_id":99,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode9.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 4 CLL\/SLL-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode9.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 4 CLL\/SLL","igblast_file_name":"SRR030813_filtered_barcode9.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,171","cell_number":"182564","ir_sequence_count":5143,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":99},{"_id":100,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode8.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 3 FL and SLL-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode8.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 3 FL and SLL","igblast_file_name":"SRR030815_filtered_barcode8.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,951","cell_number":"171714","ir_sequence_count":4932,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"small lymphocytic leukemia, follicular lymphoma","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":100},{"_id":101,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode15.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:10-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode15.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:10","igblast_file_name":"SRR030807_filtered_barcode15.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8577","cell_number":"270691","ir_sequence_count":8494,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":101},{"_id":102,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"64","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220432.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_8_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220432.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220432","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_8_3-sc-2013-01-11T14:16:54Z-1548381","igblast_file_name":"filtered_ERR220432.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,452","cell_number":"9,931","ir_sequence_count":9087,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":64,"ir_subject_age_max":64,"ir_project_sample_id":102},{"_id":103,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220417.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_11_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220417.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220417","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_11_6-sc-2013-01-11T14:16:36Z-1548363","igblast_file_name":"filtered_ERR220417.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,599","cell_number":"5,624","ir_sequence_count":5035,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":103},{"_id":104,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode21.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 1-1b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode21.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 1 time 0 replicate","igblast_file_name":"SRR030815_filtered_barcode21.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,269","cell_number":"171714","ir_sequence_count":3256,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":104},{"_id":105,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"liver","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode11.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 5 PTLD liver DLBCL-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode11.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 5 PTLD liver DLBCL","igblast_file_name":"SRR030807_filtered_barcode11.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4665","cell_number":"270691","ir_sequence_count":4481,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"post transplant lymphoproliferative disease, diffuse large B cell lymphoma in liver","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":105},{"_id":110,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":"Caucasian","sequencing_platform":"Illumina Hiseq 2000","cell_subset":"T cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"11yrs","organism":"Homo sapiens","tissue":"PBMC","collected_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","link_type":"Sibling, son","immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"TRBJ, TRBC","disease_state_sample":"Healthy","study_id":"PRJNA229070","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_du_SRR1033674.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"Child A1","lab_name":"Shemyakin-Ovchinnikov institute of Bioorganic Chemistry ","pcr_target_locus":null,"lab_address":"Russian Academy of Sciences","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":null,"complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Healthy baseline Study","ir_sra_run_id":"SRR1033674","template_amount":null,"submitted_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","mixcr_file_name":"SRR1033674_mixcr.vdjca, SRR1033674_mixcr_annotation.txt, SRR1033674_mixcr.clns, SRR1033674_mixcr_clones.txt","collection_time_event":"Blood withdrawl","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Child A1","igblast_file_name":null,"intervention":null,"linked_subjects":"Child A2, Mother A","total_reads_passing_qc_filter":"13,715,578","cell_number":"4,687,578","ir_sequence_count":3132256,"forward_PCR_primer_target_location":"TRBV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mother and child T cell receptor repertoires: deep profiling study","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":11,"ir_subject_age_max":11,"cell_tissue":"PBMC","ir_project_sample_id":110},{"_id":112,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":"Caucasian","sequencing_platform":"Illumina Hiseq 2000","cell_subset":"T cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"10yrs","organism":"Homo sapiens","tissue":"PBMC","collected_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","link_type":"Sibling, son","immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"TRBJ, TRBC","disease_state_sample":"Healthy","study_id":"PRJNA229070","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_du_SRR1033677.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"Child B2","lab_name":"Shemyakin-Ovchinnikov institute of Bioorganic Chemistry ","pcr_target_locus":null,"lab_address":"Russian Academy of Sciences","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":null,"complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Healthy baseline Study","ir_sra_run_id":"SRR1033677","template_amount":null,"submitted_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","mixcr_file_name":"SRR1033677_mixcr.vdjca, SRR1033677_mixcr_annotation.txt, SRR1033677_mixcr.clns, SRR1033677_mixcr_clones.txt","collection_time_event":"Blood withdrawl","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Child B2","igblast_file_name":null,"intervention":null,"linked_subjects":"Child B1, Mother B","total_reads_passing_qc_filter":"2,856,679","cell_number":"4,615,093","ir_sequence_count":3582672,"forward_PCR_primer_target_location":"TRBV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mother and child T cell receptor repertoires: deep profiling study","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":10,"ir_subject_age_max":10,"cell_tissue":"PBMC","ir_project_sample_id":112},{"_id":111,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875298_filtered_1.fastq -r ERR875298_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875298.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"4","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875299.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"F3NCpre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875299_aa.txz, ERR875299_ab.txz, ERR875299_ac.txz, ERR875299_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875299","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 3 Non-carrier","igblast_file_name":"ERR875299.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,400,216","cell_number":"2,634,244","ir_sequence_count":1633051,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg non-carrier unvaccinated","ir_subject_age_min":4,"ir_subject_age_max":4,"ir_project_sample_id":111},{"_id":113,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"50","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode50.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"50","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode50.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"50","igblast_file_name":" SRR030822_filtered_barcode50.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,240","cell_number":"433784","ir_sequence_count":5047,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":50,"ir_subject_age_max":50,"ir_project_sample_id":113},{"_id":114,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875294_filtered_1.fastq -r ERR875294_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875294.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"12","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875295.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"F2Cpre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875295_aa.txz, ERR875295_ab.txz, ERR875295_ac.txz, ERR875295_ad.txz, ERR875295_ae.txz, ERR875295_af.txz, ERR875295_ag.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875295","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 2 Carrier","igblast_file_name":"ERR875295.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,364,283","cell_number":"5,274,181","ir_sequence_count":3261822,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg carrier unvaccinated","ir_subject_age_min":12,"ir_subject_age_max":12,"ir_project_sample_id":114},{"_id":116,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"bone marrow","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode10.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 5 PTLD marrow infiltrate-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode10.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 5 PTLD marrow infiltrate","igblast_file_name":"SRR030809_filtered_barcode10.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7021","cell_number":"251408","ir_sequence_count":6935,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"post transplant lymphoproliferative disease, diffuse large B cell lymphoma in liver","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":116},{"_id":115,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode9.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-c ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode9.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030816_filtered_barcode9.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,838","cell_number":"635307","ir_sequence_count":3789,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":115},{"_id":118,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode18.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:10000-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode18.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:10000","igblast_file_name":"SRR030813_filtered_barcode18.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,636","cell_number":"182564","ir_sequence_count":5612,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":118},{"_id":119,"collapsing_method":null,"collection_time_point_relative":"Day 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875293_filtered_1.fastq -r ERR875293_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875293.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"14","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875294.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"F2NCpost","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875294_aa.txz, ERR875294_ab.txz, ERR875294_ac.txz, ERR875294_ad.txz, ERR875294_ae.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875294","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 2 Non-carrier","igblast_file_name":"ERR875294.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,904,961","cell_number":"3,735,856","ir_sequence_count":2257018,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg non-carrier vaccinated","ir_subject_age_min":14,"ir_subject_age_max":14,"ir_project_sample_id":119},{"_id":121,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode4.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-d","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode4.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030816_filtered_barcode4.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,006","cell_number":"635307","ir_sequence_count":2000,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":121},{"_id":123,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"34","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298743.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"43213_PBMC","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298743.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298743","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"43213_PBMC","igblast_file_name":"filtered_SRR1298743.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"97691","cell_number":null,"ir_sequence_count":162675,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":34,"ir_subject_age_max":34,"ir_project_sample_id":123},{"_id":124,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode2.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-b","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030816_filtered_barcode2.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,893","cell_number":"635307","ir_sequence_count":1885,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":124},{"_id":125,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"45","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode45a.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"45a","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode45a.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"45","igblast_file_name":" SRR030822_filtered_barcode45a.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,311","cell_number":"433784","ir_sequence_count":4529,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":45,"ir_subject_age_max":45,"ir_project_sample_id":125},{"_id":126,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"68","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220460.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_5_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220460.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220460","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_5_3-sc-2013-01-11T14:17:25Z-1548412","igblast_file_name":"filtered_ERR220460.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,506","cell_number":"9,380","ir_sequence_count":8136,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":68,"ir_subject_age_max":68,"ir_project_sample_id":126},{"_id":128,"collapsing_method":null,"collection_time_point_relative":"sampled 9\/4\/2009","sequencing_facility":null,"cell_phenotype":" CD3-, CD14-, CD19+, CD20+, IgG+, IgM-, RSC3+","paired_read_assembly":null,"ethnicity":"African","sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":">18 years","organism":"Homo sapiens","tissue":"PBMC","collected_by":"T. Zhu, J. Zhou, P.D. Kwong, ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"C Region","disease_state_sample":"HIV+","study_id":"PRJNA195543","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_SRR800639heavyandlight_split1.fasta, filtered_SRR800639heavyandlight_split2.fasta, unfiltered_SRR800639heavyandlight_split1.fasta, unfiltered_SRR800639heavyandlight_split2.fasta","library_construction_method":"other","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"other","study_group_description":"Case","sample_id":"IAVI 57","lab_name":"Vaccine Research Center","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR800639heavyandlight_split1.txz, filtered_SRR800639heavyandlight_split2.txz, unfiltered_SRR800639heavyandlight_split1.txz, unfiltered_SRR800639heavyandlight_split2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR800639","template_amount":null,"submitted_by":"T. Zhu, J. Zhou, P.D. Kwong, ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"IAVI 57","igblast_file_name":null,"intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"501,931","cell_number":"608,358","ir_sequence_count":501931,"forward_PCR_primer_target_location":"V gene specific","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Multi-donor Analysis Reveal Structural Elements, Genetic Determinants, and Maturation Pathway for Effective HIV-1 Neutralization by VRC01-class Antibodies","pub_ids":null,"disease_diagnosis":"HIV-1 infected clade CRF02-AG, off of antiretroviral treatment","ir_subject_age_min":18,"ir_subject_age_max":9999,"ir_project_sample_id":128},{"_id":130,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode1.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-a","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode1.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030817_filtered_barcode1.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"10,664","cell_number":"556038","ir_sequence_count":10640,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":130},{"_id":132,"collapsing_method":null,"collection_time_point_relative":"time 3 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode6.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 1 CLL\/SLL-2-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode6.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 1 CLL\/SLL time 3 months","igblast_file_name":"SRR030815_filtered_barcode6.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,617","cell_number":"171714","ir_sequence_count":7587,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":132},{"_id":134,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"24","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220445.barcode3.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_11_barcode3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220445.barcode3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220445","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_11_barcode3","igblast_file_name":"filtered_ERR220445.barcode3.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"124,793","cell_number":"116,740","ir_sequence_count":70976,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":24,"ir_subject_age_max":24,"ir_project_sample_id":134},{"_id":138,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"60","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode60.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"60","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode60.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"60","igblast_file_name":" SRR030822_filtered_barcode60.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,553","cell_number":"433784","ir_sequence_count":6253,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":60,"ir_subject_age_max":60,"ir_project_sample_id":138},{"_id":139,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"64","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220437.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_8_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220437.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220437","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_8_8-sc-2013-01-11T14:16:59Z-1548386","igblast_file_name":"filtered_ERR220437.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,397","cell_number":"7,171","ir_sequence_count":4686,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":64,"ir_subject_age_max":64,"ir_project_sample_id":139},{"_id":140,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"25","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode25.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"25","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode25.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"25","igblast_file_name":" SRR030822_filtered_barcode25.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,530","cell_number":"433784","ir_sequence_count":4479,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":25,"ir_subject_age_max":25,"ir_project_sample_id":140},{"_id":141,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode7.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-a ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode7.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030817_filtered_barcode7.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,089","cell_number":"556038","ir_sequence_count":5035,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":141},{"_id":144,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode28.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 3c2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode28.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 14 months replicate","igblast_file_name":"SRR030813_filtered_barcode28.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,290","cell_number":"182564","ir_sequence_count":4277,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":144},{"_id":146,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"55","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220450.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220450.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220450","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_6-sc-2013-01-11T14:17:15Z-1548401","igblast_file_name":"filtered_ERR220450.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"27,675","cell_number":"32,428","ir_sequence_count":19408,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":55,"ir_subject_age_max":55,"ir_project_sample_id":146},{"_id":147,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278155_filtered_1.fastq -r ERR1278155_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278155.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"47","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278155.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A3pre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278155_aa.txz, ERR1278155_ab.txz, ERR1278155_ac.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278155","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 3","igblast_file_name":"ERR1278155.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,316,424","cell_number":"2,830,403","ir_sequence_count":1091249,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":47,"ir_subject_age_max":47,"ir_project_sample_id":147},{"_id":151,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"54","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298732.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"26712_CSF","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298732.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298732 ","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"26712_CSF","igblast_file_name":"filtered_SRR1298732.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"149015","cell_number":null,"ir_sequence_count":4846,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":54,"ir_subject_age_max":54,"ir_project_sample_id":151},{"_id":153,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"22","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298383.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":" 29612_PBMC","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298383.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298383","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"29612_PBMC","igblast_file_name":"filtered_SRR1298383.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"118607","cell_number":null,"ir_sequence_count":148142,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":22,"ir_subject_age_max":22,"ir_project_sample_id":153},{"_id":154,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875302_filtered_1.fastq -r ERR875302_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875302.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"3","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875303.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"F4Cpre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875303_aa.txz, ERR875303_ab.txz, ERR875303_ac.txz, ERR875303_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875303","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 4 Carrier","igblast_file_name":"ERR875303.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,485,869","cell_number":"2,706,342","ir_sequence_count":1617248,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg carrier unvaccinated","ir_subject_age_min":3,"ir_subject_age_max":3,"ir_project_sample_id":154},{"_id":158,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode13.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode13.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL","igblast_file_name":"SRR030813_filtered_barcode13.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,191","cell_number":"182564","ir_sequence_count":5179,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":158},{"_id":160,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"24","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220445.barcode11.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_11_barcode11","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220445.barcode11.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220445","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_11_barcode11","igblast_file_name":"filtered_ERR220445.barcode11.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"37,929","cell_number":"55,035","ir_sequence_count":8314,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":24,"ir_subject_age_max":24,"ir_project_sample_id":160},{"_id":164,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220404.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220404.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220404","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_6-sc-2013-01-11T14:16:20Z-1548349","igblast_file_name":"filtered_ERR220404.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,284","cell_number":"11,580","ir_sequence_count":9744,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":164},{"_id":162,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"19","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode19.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"19","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode19.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"19","igblast_file_name":" SRR030820_filtered_barcode19.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"12,377","cell_number":"422073","ir_sequence_count":12119,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":19,"ir_subject_age_max":19,"ir_project_sample_id":162},{"_id":163,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode2.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-1b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1","igblast_file_name":"SRR030807_filtered_barcode2.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"14513","cell_number":"270691","ir_sequence_count":14351,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":163},{"_id":165,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220424.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_6_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220424.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220424","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_6_7-sc-2013-01-11T14:16:44Z-1548371","igblast_file_name":"filtered_ERR220424.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,259","cell_number":"12,001","ir_sequence_count":9864,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":165},{"_id":166,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode13.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Normal control-a1,3","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode13.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Normal control","igblast_file_name":" SRR030817_filtered_barcode13.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"11,215","cell_number":"556038","ir_sequence_count":11137,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":166},{"_id":168,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"bone marrow","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode10.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 5 PTLD marrow infiltrate-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode10.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 5 PTLD marrow infiltrate","igblast_file_name":"SRR030815_filtered_barcode10.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,394","cell_number":"171714","ir_sequence_count":3380,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"posttransplant lymphoproliferative disease, diffuse large B cell lymphoma in liver","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":168},{"_id":172,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode2.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-b","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030817_filtered_barcode2.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,659","cell_number":"556038","ir_sequence_count":1648,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":172},{"_id":171,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220455.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_4_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220455.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220455","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_4_4-sc-2013-01-11T14:17:19Z-1548406","igblast_file_name":"filtered_ERR220455.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,688","cell_number":"7,650","ir_sequence_count":5771,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":171},{"_id":176,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220398.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_10_1","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220398.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220398","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_10-sc-2013-01-11T14:16:13Z-1548343","igblast_file_name":"filtered_ERR220398.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"31,137","cell_number":"11,146","ir_sequence_count":8872,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":176},{"_id":175,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"77","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220438.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_9_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220438.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220438","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_9_3-sc-2013-01-11T14:17:01Z-1548388","igblast_file_name":"filtered_ERR220438.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,416","cell_number":"7,863","ir_sequence_count":7275,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":77,"ir_subject_age_max":77,"ir_project_sample_id":175},{"_id":178,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"59","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220403.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220403.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220403","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_5-sc-2013-01-11T14:16:19Z-1548348","igblast_file_name":"filtered_ERR220403.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,469","cell_number":"52,242","ir_sequence_count":25522,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":59,"ir_subject_age_max":59,"ir_project_sample_id":178},{"_id":179,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":"Caucasian","sequencing_platform":"Illumina Hiseq 2000","cell_subset":"T cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"9yrs","organism":"Homo sapiens","tissue":"PBMC","collected_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","link_type":"Sibling, son","immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"TRBJ, TRBC","disease_state_sample":"Healthy","study_id":"PRJNA229070","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_du_SRR1033675.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"Child A2","lab_name":"Shemyakin-Ovchinnikov institute of Bioorganic Chemistry ","pcr_target_locus":null,"lab_address":"Russian Academy of Sciences","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":null,"complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Healthy baseline Study","ir_sra_run_id":"SRR1033675","template_amount":null,"submitted_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","mixcr_file_name":"SRR1033675_mixcr.vdjca, SRR1033675_mixcr_annotation.txt, SRR1033675_mixcr.clns, SRR1033675_mixcr_clones.txt","collection_time_event":"Blood withdrawl","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Child A2","igblast_file_name":null,"intervention":null,"linked_subjects":"Child A1, Mother A","total_reads_passing_qc_filter":"10,344,067","cell_number":"4,202,419","ir_sequence_count":3030212,"forward_PCR_primer_target_location":"TRBV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mother and child T cell receptor repertoires: deep profiling study","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":9,"ir_subject_age_max":9,"cell_tissue":"PBMC","ir_project_sample_id":179},{"_id":180,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode9.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 4 CLL\/SLL-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode9.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 4 CLL\/SLL","igblast_file_name":"SRR030815_filtered_barcode9.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,041","cell_number":"171714","ir_sequence_count":5017,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":180},{"_id":181,"collapsing_method":null,"collection_time_point_relative":"Week 2 ","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278160_filtered_1.fastq -r ERR1278160_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278160.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"37","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278160.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A4wk2","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278160_aa.txz, ERR1278160_ab.txz, ERR1278160_ac.txz, ERR1278160_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278160","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 4","igblast_file_name":"ERR1278160.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,420,729","cell_number":"2,033,064","ir_sequence_count":1855317,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":37,"ir_subject_age_max":37,"ir_project_sample_id":181},{"_id":182,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode20.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 1-1a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode20.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 1 time 0","igblast_file_name":"SRR030815_filtered_barcode20.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,424","cell_number":"171714","ir_sequence_count":4398,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":182},{"_id":185,"collapsing_method":null,"collection_time_point_relative":"Day 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875295_filtered_1.fastq -r ERR875295_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875295.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"12","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875296.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"F2Cpost","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875296_aa.txz, ERR875296_ab.txz, ERR875296_ac.txz, ERR875296_ad.txz, ERR875296_ae.txz, ERR875296_af.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875296","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 2 Carrier","igblast_file_name":"ERR875296.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,257,018","cell_number":"4,373,440","ir_sequence_count":2782921,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg carrier vaccinated","ir_subject_age_min":12,"ir_subject_age_max":12,"ir_project_sample_id":185},{"_id":187,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"78","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode78.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"78","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode78.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"78","igblast_file_name":" SRR030820_filtered_barcode78.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,901","cell_number":"422073","ir_sequence_count":6263,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":78,"ir_subject_age_max":78,"ir_project_sample_id":187},{"_id":2,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"32","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode32.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"32","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode32.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"32","igblast_file_name":" SRR030822_filtered_barcode32.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,219","cell_number":"433784","ir_sequence_count":4182,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":32,"ir_subject_age_max":32,"ir_project_sample_id":2},{"_id":188,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode4.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-3b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode4.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1 time 14 months replicate","igblast_file_name":"SRR030815_filtered_barcode4.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,355","cell_number":"171714","ir_sequence_count":3334,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":188},{"_id":190,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode14.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 3-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode14.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 3","igblast_file_name":"SRR030813_filtered_barcode14.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,129","cell_number":"182564","ir_sequence_count":5099,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":190},{"_id":191,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"20","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode20.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"20","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode20.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"20","igblast_file_name":" SRR030822_filtered_barcode20.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,749","cell_number":"433784","ir_sequence_count":8654,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":20,"ir_subject_age_max":20,"ir_project_sample_id":191},{"_id":194,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"24","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220445.barcode1.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_10_barcode1","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220445.barcode1.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220445","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_10_barcode1","igblast_file_name":"filtered_ERR220445.barcode1.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"42,922","cell_number":"79,153","ir_sequence_count":52304,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":24,"ir_subject_age_max":24,"ir_project_sample_id":194},{"_id":193,"collapsing_method":null,"collection_time_point_relative":"time 3 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode6.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 1 CLL\/SLL-2a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode6.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 1 CLL\/SLL time 3 months","igblast_file_name":"SRR030813_filtered_barcode6.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,040","cell_number":"182564","ir_sequence_count":8006,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":193},{"_id":198,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"20","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode20.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"20","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode20.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"20","igblast_file_name":" SRR030820_filtered_barcode20.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,604","cell_number":"422073","ir_sequence_count":8458,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":20,"ir_subject_age_max":20,"ir_project_sample_id":198},{"_id":195,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode17.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:1000-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode17.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:1000","igblast_file_name":"SRR030809_filtered_barcode17.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"10407","cell_number":"251408","ir_sequence_count":10303,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":195},{"_id":199,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"42","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode42.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"42","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode42.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"42","igblast_file_name":" SRR030820_filtered_barcode42.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,359","cell_number":"422073","ir_sequence_count":2794,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":42,"ir_subject_age_max":42,"ir_project_sample_id":199},{"_id":203,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"78","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode78.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"78","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode78.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"78","igblast_file_name":" SRR030822_filtered_barcode78.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,147","cell_number":"433784","ir_sequence_count":6455,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":78,"ir_subject_age_max":78,"ir_project_sample_id":203},{"_id":204,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode27.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 3b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode27.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 14 months replicate","igblast_file_name":"SRR030813_filtered_barcode27.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,388","cell_number":"182564","ir_sequence_count":3372,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":204},{"_id":207,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode18.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:10000-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode18.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:10000","igblast_file_name":"SRR030809_filtered_barcode18.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"16437","cell_number":"251408","ir_sequence_count":16223,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":207},{"_id":210,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"43","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298739.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"34012_PBMC","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298739.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298739 ","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"34012_PBMC","igblast_file_name":"filtered_SRR1298739.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"176463","cell_number":null,"ir_sequence_count":97286,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":43,"ir_subject_age_max":43,"ir_project_sample_id":210},{"_id":211,"collapsing_method":null,"collection_time_point_relative":"Week 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278150_filtered_1.fastq -r ERR1278150_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278150.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"42","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278150.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A1wk1","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278150_aa.txz, ERR1278150_ab.txz, ERR1278150_ac.txz, ERR1278150_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278150","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 1","igblast_file_name":"ERR1278150.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,784,287","cell_number":"3,303,418","ir_sequence_count":1951899,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":42,"ir_subject_age_max":42,"ir_project_sample_id":211},{"_id":213,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"liver","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode11.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 5 PTLD liver DLBCL-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode11.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 5 PTLD liver DLBCL","igblast_file_name":"SRR030809_filtered_barcode11.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4506","cell_number":"251408","ir_sequence_count":4302,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"post transplant lymphoproliferative disease, diffuse large B cell lymphoma in liver","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":213},{"_id":215,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode6.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-f","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode6.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030816_filtered_barcode6.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,023","cell_number":"635307","ir_sequence_count":3007,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":215},{"_id":216,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220421.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_6_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220421.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220421","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_6_4-sc-2013-01-11T14:16:41Z-1548368","igblast_file_name":"filtered_ERR220421.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,770","cell_number":"10,516","ir_sequence_count":7892,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":216},{"_id":218,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode14.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 3-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode14.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 3","igblast_file_name":"SRR030809_filtered_barcode14.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"16655","cell_number":"251408","ir_sequence_count":16525,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":218},{"_id":220,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"74","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220444.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"Healthy_1","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220444.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220444","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_1-sc-2013-01-11T14:17:09Z-1548395","igblast_file_name":"filtered_ERR220444.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"72,007","cell_number":"49,943","ir_sequence_count":29808,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":74,"ir_subject_age_max":74,"ir_project_sample_id":220},{"_id":222,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220419.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_11_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220419.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220419","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_11_8-sc-2013-01-11T14:16:37Z-1548365","igblast_file_name":"filtered_ERR220419.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,902","cell_number":"4,427","ir_sequence_count":3588,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":222},{"_id":221,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"61","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode61.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"61","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode61.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"61","igblast_file_name":" SRR030822_filtered_barcode61.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9,806","cell_number":"433784","ir_sequence_count":5493,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":61,"ir_subject_age_max":61,"ir_project_sample_id":221},{"_id":224,"collapsing_method":null,"collection_time_point_relative":"one time point Jan 2011","sequencing_facility":null,"cell_phenotype":"CD19+, IgM-, IgD-, IgA-","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"PBMC","collected_by":"P.D. Kwong, J. Zhu, G. Ofek","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"downstream from end of J chain","disease_state_sample":"HIV+","study_id":"PRJNA188191","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_SRR654172light_split1.fasta, filtered_SRR654172light_split2.fasta, filtered_SRR654172light_split3.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptome","study_group_description":"Case","sample_id":"N152-Light Chain","lab_name":"Kwong Lab","pcr_target_locus":null,"lab_address":"National Institute of Allergy and Infectious Disease-Vaccine Research Center","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR654172light_split1.txz, filtered_SRR654172light_split2.txz, filtered_SRR654172light_split3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR654172","template_amount":null,"submitted_by":"P.D. Kwong, J. Zhu, G. Ofek","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"N152","igblast_file_name":"filtered_SRR654172light_split1_igblast.fmt7, filtered_SRR654172light_split2_igblast.fmt7, filtered_SRR654172light_split3_igblast.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,160,314","cell_number":"1.2 million","ir_sequence_count":1160314,"forward_PCR_primer_target_location":"Upstream from start of V-gene leader Sequence ","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mining the antibodyome for HIV-1 neutralizing antibodies with next generation sequencing and phylogenetic pairing of heavy\/light chains","pub_ids":null,"disease_diagnosis":"HIV-1 infected for 20 years off antiretroviral treament","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"PBMC","ir_project_sample_id":224},{"_id":225,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"68","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode68.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"68","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode68.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"68","igblast_file_name":" SRR030820_filtered_barcode68.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,255","cell_number":"422073","ir_sequence_count":9382,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":68,"ir_subject_age_max":68,"ir_project_sample_id":225},{"_id":226,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode7.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-a ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode7.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030816_filtered_barcode7.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,862","cell_number":"635307","ir_sequence_count":5819,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":226},{"_id":233,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"62","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220446.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_2","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220446.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220446","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_2-sc-2013-01-11T14:17:11Z-1548397","igblast_file_name":"filtered_ERR220446.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,703","cell_number":"59,088","ir_sequence_count":36726,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":62,"ir_subject_age_max":62,"ir_project_sample_id":233},{"_id":232,"collapsing_method":null,"collection_time_point_relative":"one time point","sequencing_facility":null,"cell_phenotype":"IgG+, CD19+, sIgG+, negative depletion to CD3, CD14, CD16, IgM, IgA, IgD ","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":">18 years","organism":"Homo sapiens","tissue":"PBMC","collected_by":"P.D. Kwong, J. Zhu, G. Ofek","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"downstream from end of J chain","disease_state_sample":"HIV+","study_id":"PRJNA188191","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_SRR654170light_split1.fasta, filtered_SRR654170light_split2.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptome","study_group_description":"Case","sample_id":"IAVI 84-Light Chain","lab_name":"Kwong Lab","pcr_target_locus":null,"lab_address":"National Institute of Allergy and Infectious Disease-Vaccine Research Center","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR654170light_split1.txz, filtered_SRR654170light_split2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR654170","template_amount":null,"submitted_by":"P.D. Kwong, J. Zhu, G. Ofek","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"IAVI 84","igblast_file_name":"filtered_SRR654170light_split1_igblast.fmt7, filtered_SRR654170light_split2_igblast.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"873,979","cell_number":"973,868","ir_sequence_count":873979,"forward_PCR_primer_target_location":"Upstream from start of V-gene leader Sequence ","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mining the antibodyome for HIV-1 neutralizing antibodies with next generation sequencing and phylogenetic pairing of heavy\/light chains","pub_ids":null,"disease_diagnosis":"HIV-1 infected for at least 3 years, not receiving antiretroviral treatment","ir_subject_age_min":18,"ir_subject_age_max":9999,"cell_tissue":"PBMC","ir_project_sample_id":232},{"_id":231,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode4.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-3b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode4.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1","igblast_file_name":"SRR030807_filtered_barcode4.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"11505","cell_number":"270691","ir_sequence_count":11387,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":231},{"_id":234,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"60","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode60.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"60","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode60.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"60","igblast_file_name":" SRR030820_filtered_barcode60.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,621","cell_number":"422073","ir_sequence_count":6097,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":60,"ir_subject_age_max":60,"ir_project_sample_id":234},{"_id":236,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"77","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220440.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_9_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220440.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220440","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_9_5-sc-2013-01-11T14:17:03Z-1548390","igblast_file_name":"filtered_ERR220440.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,254","cell_number":"2,857","ir_sequence_count":2411,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":77,"ir_subject_age_max":77,"ir_project_sample_id":236},{"_id":238,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode1.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-1a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode1.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1 time 0","igblast_file_name":"SRR030815_filtered_barcode1.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,000","cell_number":"171714","ir_sequence_count":4969,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":238},{"_id":242,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"61","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode61.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"61","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode61.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"61","igblast_file_name":" SRR030820_filtered_barcode61.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9,586","cell_number":"422073","ir_sequence_count":5527,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":61,"ir_subject_age_max":61,"ir_project_sample_id":242},{"_id":241,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"77","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220439.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_9_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220439.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220439","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_9_4-sc-2013-01-11T14:17:02Z-1548389","igblast_file_name":"filtered_ERR220439.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,042","cell_number":"3,951","ir_sequence_count":3391,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":77,"ir_subject_age_max":77,"ir_project_sample_id":241},{"_id":243,"collapsing_method":null,"collection_time_point_relative":"one time point","sequencing_facility":null,"cell_phenotype":"IgG+, CD19+, sIgG+, negative depletion to CD3, CD14, CD16, IgM, IgA, IgD ","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":">18 years","organism":"Homo sapiens","tissue":"PBMC","collected_by":"P.D. Kwong, J. Zhu, G. Ofek","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"downstream from end of J chain","disease_state_sample":"HIV+","study_id":"PRJNA188191","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR654169heavy_split1.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptome","study_group_description":"Case","sample_id":"IAVI 84-Heavy Chain","lab_name":"Kwong Lab","pcr_target_locus":null,"lab_address":"National Institute of Allergy and Infectious Disease-Vaccine Research Center","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR654169heavy_split1.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR654169","template_amount":null,"submitted_by":"P.D. Kwong, J. Zhu, G. Ofek","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"IAVI 84","igblast_file_name":"filtered_SRR654169heavy_split1_igblast.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"253,683","cell_number":"279,503","ir_sequence_count":253683,"forward_PCR_primer_target_location":"Upstream from start of V-gene leader Sequence ","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mining the antibodyome for HIV-1 neutralizing antibodies with next generation sequencing and phylogenetic pairing of heavy\/light chains","pub_ids":null,"disease_diagnosis":"HIV-1 infected for at least 3 years, not receiving antiretroviral treatment","ir_subject_age_min":18,"ir_subject_age_max":9999,"cell_tissue":"PBMC","ir_project_sample_id":243},{"_id":244,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220408.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_10_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220408.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220408","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_10_3-sc-2013-01-11T14:16:25Z-1548353","igblast_file_name":"filtered_ERR220408.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,463","cell_number":"11,425","ir_sequence_count":9933,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":244},{"_id":246,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"79","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode79.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"79","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode79.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"79","igblast_file_name":" SRR030822_filtered_barcode79.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,590,922","cell_number":"433784","ir_sequence_count":5101,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":79,"ir_subject_age_max":79,"ir_project_sample_id":246},{"_id":249,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode1.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-1a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode1.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1 time 0","igblast_file_name":"SRR030813_filtered_barcode1.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,355","cell_number":"182564","ir_sequence_count":5336,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":249},{"_id":248,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"37","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode37.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"37","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode37.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"37","igblast_file_name":" SRR030820_filtered_barcode37.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,531","cell_number":"422073","ir_sequence_count":3480,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":37,"ir_subject_age_max":37,"ir_project_sample_id":248},{"_id":250,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220414.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_11_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220414.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220414","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_11_3-sc-2013-01-11T14:16:33Z-1548360","igblast_file_name":"filtered_ERR220414.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,091","cell_number":"7,381","ir_sequence_count":6796,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":250},{"_id":252,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode1.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-1a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode1.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1","igblast_file_name":"SRR030807_filtered_barcode1.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9429","cell_number":"270691","ir_sequence_count":9303,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":252},{"_id":253,"collapsing_method":null,"collection_time_point_relative":"sampled 2\/5\/2008","sequencing_facility":null,"cell_phenotype":" CD3-, CD14-, CD19+, CD20+, IgG+, IgM-, RSC3+","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":">18 years","organism":"Homo sapiens","tissue":"PBMC","collected_by":"T. Zhu, J. Zhou, P.D. Kwong, ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"C Region","disease_state_sample":"HIV+","study_id":"PRJNA195543","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_SRR800640heavyandlight_split1.fasta, filtered_SRR800640heavyandlight_split2.fasta, filtered_SRR800640heavyandlight_split3.fasta, unfiltered_SRR800640heavyandlight_split1.fasta, unfiltered_SRR800640heavyandlight_split2.fasta, unfiltered_SRR800640heavyandlight_split3.fasta","library_construction_method":"other","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"other","study_group_description":"Case","sample_id":"IAVI 74","lab_name":"Vaccine Research Center","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR800640heavyandlight_split1.txz, filtered_SRR800640heavyandlight_split2.txz, filtered_SRR800640heavyandlight_split3.txz, unfiltered_SRR800640heavyandlight_split1.txz, unfiltered_SRR800640heavyandlight_split2.txz, unfiltered_SRR800640heavyandlight_split3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR800640","template_amount":null,"submitted_by":"T. Zhu, J. Zhou, P.D. Kwong, ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"IAVI 74","igblast_file_name":null,"intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,192,320","cell_number":"1.3 million","ir_sequence_count":1192320,"forward_PCR_primer_target_location":"V gene specific","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Multi-donor Analysis Reveal Structural Elements, Genetic Determinants, and Maturation Pathway for Effective HIV-1 Neutralization by VRC01-class Antibodies","pub_ids":null,"disease_diagnosis":"HIV-1 infected clade A\/D, off of antiretroviral treatment","ir_subject_age_min":18,"ir_subject_age_max":9999,"ir_project_sample_id":253},{"_id":255,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"75","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220447.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220447.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220447","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_3-sc-2013-01-11T14:17:12Z-1548398","igblast_file_name":"filtered_ERR220447.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,804","cell_number":"47,363","ir_sequence_count":30559,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":75,"ir_subject_age_max":75,"ir_project_sample_id":255},{"_id":257,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode12.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"healthy donor 2-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode12.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"healthy donor 2","igblast_file_name":"SRR030813_filtered_barcode12.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,862","cell_number":"182564","ir_sequence_count":6833,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":257},{"_id":258,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode3.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-3a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1 time 14 months","igblast_file_name":"SRR030815_filtered_barcode3.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,095","cell_number":"171714","ir_sequence_count":5074,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":258},{"_id":259,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"75","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode75.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"75","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode75.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"75","igblast_file_name":" SRR030820_filtered_barcode75.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,392","cell_number":"422073","ir_sequence_count":5915,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":75,"ir_subject_age_max":75,"ir_project_sample_id":259},{"_id":260,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode12.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"unrelated CLL","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode12.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"unrelated CLL","igblast_file_name":" SRR030816_filtered_barcode12.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,269","cell_number":"635307","ir_sequence_count":8229,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":260},{"_id":261,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":"Caucasian","sequencing_platform":"Illumina Hiseq 2000","cell_subset":"T cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"16yrs","organism":"Homo sapiens","tissue":"PBMC","collected_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","link_type":"Sibling, son","immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"TRBJ, TRBC","disease_state_sample":"Healthy","study_id":"PRJNA229070","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_du_SRR1033676.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"Child B1","lab_name":"Shemyakin-Ovchinnikov institute of Bioorganic Chemistry ","pcr_target_locus":null,"lab_address":"Russian Academy of Sciences","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":null,"complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Healthy baseline Study","ir_sra_run_id":"SRR1033676","template_amount":null,"submitted_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","mixcr_file_name":"SRR1033676_mixcr.vdjca, SRR1033676_mixcr_annotation.txt, SRR1033676_mixcr.clns, SRR1033676_mixcr_clones.txt","collection_time_event":"Blood withdrawl","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Child B1","igblast_file_name":null,"intervention":null,"linked_subjects":"Child B2, Mother B","total_reads_passing_qc_filter":"3,380,219","cell_number":"4,830,536","ir_sequence_count":3873361,"forward_PCR_primer_target_location":"TRBV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mother and child T cell receptor repertoires: deep profiling study","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":16,"ir_subject_age_max":16,"cell_tissue":"PBMC","ir_project_sample_id":261},{"_id":263,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"37","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298737.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"31012_PBMC","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298737.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298737","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"31012_PBMC","igblast_file_name":"filtered_SRR1298737.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"149015","cell_number":null,"ir_sequence_count":161449,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":37,"ir_subject_age_max":37,"ir_project_sample_id":263},{"_id":262,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode7.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 2 FL-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode7.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 2 FL","igblast_file_name":"SRR030815_filtered_barcode7.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,124","cell_number":"171714","ir_sequence_count":3112,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"follicular lymphoma","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":262},{"_id":264,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"31","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode31.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"31","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode31.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"31","igblast_file_name":" SRR030822_filtered_barcode31.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,037","cell_number":"433784","ir_sequence_count":3004,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":31,"ir_subject_age_max":31,"ir_project_sample_id":264},{"_id":265,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode26.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 3a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode26.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 14 months","igblast_file_name":"SRR030815_filtered_barcode26.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,704","cell_number":"171714","ir_sequence_count":3686,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":265},{"_id":269,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode12.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"unrelated CLL","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode12.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"unrelated CLL","igblast_file_name":" SRR030817_filtered_barcode12.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,037","cell_number":"556038","ir_sequence_count":7006,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":269},{"_id":270,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"PEAR (Galaxy Version, Minimum possible length of the assembled sequences=60, Minimum length of reads after trimming the low quality part=60, Quality score threshold for triming the low quality part of a read=30, All else default values","ethnicity":"Caucasian","sequencing_platform":"Illumina Hiseq 2000","cell_subset":"T cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"36yrs","organism":"Homo sapiens","tissue":"PBMC","collected_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","link_type":"Son, son","immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"TRBJ, TRBC","disease_state_sample":"Healthy","study_id":"PRJNA229070","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR1033671_split_aa.fasta, SRR1033671_split_ab.fasta, SRR1033671_split_ac.fasta, SRR1033671_split_ad.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"Mother A","lab_name":"Shemyakin-Ovchinnikov institute of Bioorganic Chemistry ","pcr_target_locus":null,"lab_address":"Russian Academy of Sciences","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":null,"complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Healthy baseline Study","ir_sra_run_id":"SRR1033671","template_amount":null,"submitted_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","mixcr_file_name":"SRR1033671_aa_mixcr.vdjca, SRR1033671_aa_mixcr_annotation.txt, SRR1033671_ab_mixcr.vdjca, SRR1033671_ab_mixcr_annotation.txt, SRR1033671_ac_mixcr.vdjca, SRR1033671_ac_mixcr_annotation.txt, SRR1033671_ad_mixcr.vdjca, SRR1033671_ad_mixcr_annotation.txt, SRR1033671_aa_mixcr.clns, SRR1033671_aa_mixcr_clones.txt, SRR1033671_ab_mixcr.clns, SRR1033671_ab_mixcr_clones.txt, SRR1033671_ac_mixcr.clns, SRR1033671_ac_mixcr_clones.txt, SRR1033671_ad_mixcr.clns, SRR1033671_ad_mixcr_clones.txt","collection_time_event":"Blood withdrawl","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Mother A","igblast_file_name":null,"intervention":null,"linked_subjects":"Child A1, Child A2","total_reads_passing_qc_filter":"1,958,439","cell_number":"13,656,054","ir_sequence_count":12443081,"forward_PCR_primer_target_location":"TRBV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mother and child T cell receptor repertoires: deep profiling study","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":36,"ir_subject_age_max":36,"cell_tissue":"PBMC","ir_project_sample_id":270},{"_id":271,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode19.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:100000-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode19.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:100000","igblast_file_name":"SRR030815_filtered_barcode19.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,279","cell_number":"171714","ir_sequence_count":4243,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":271},{"_id":272,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode6.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-f","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode6.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030817_filtered_barcode6.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,757","cell_number":"556038","ir_sequence_count":2738,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":272},{"_id":274,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode8.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 3 FL and SLL-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode8.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 3 FL and SLL","igblast_file_name":"SRR030809_filtered_barcode8.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"13937","cell_number":"251408","ir_sequence_count":13875,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"small lymphocytic leukemia, follicular lymphoma","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":274},{"_id":276,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode16.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:100-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode16.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:100","igblast_file_name":"SRR030807_filtered_barcode16.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"16483","cell_number":"270691","ir_sequence_count":16367,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":276},{"_id":279,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875300_filtered_1.fastq -r ERR875300_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875300.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"5","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875301.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"F4NCpre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875301_aa.txz, ERR875301_ab.txz, ERR875301_ac.txz, ERR875301_ad.txz, ERR875301_ae.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875301","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 4 Non-carrier","igblast_file_name":"ERR875301.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,633,051","cell_number":"3,841,175","ir_sequence_count":2485869,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg non-carrier unvaccinated","ir_subject_age_min":5,"ir_subject_age_max":5,"ir_project_sample_id":279},{"_id":282,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"24","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220445.barcode15.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_13_barcode15","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220445.barcode15.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220445","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_13_barcode15","igblast_file_name":"filtered_ERR220445.barcode15.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"31,224","cell_number":"72,125","ir_sequence_count":37714,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":24,"ir_subject_age_max":24,"ir_project_sample_id":282},{"_id":284,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"liver","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode11.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 5 PTLD liver DLBCL-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode11.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 5 PTLD liver DLBCL","igblast_file_name":"SRR030815_filtered_barcode11.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,196","cell_number":"171714","ir_sequence_count":3104,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"posttransplant lymphoproliferative disease, diffuse large B cell lymphoma in liver","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":284},{"_id":286,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"69","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220426.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_7_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220426.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220426","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_7_3-sc-2013-01-11T14:16:46Z-1548374","igblast_file_name":"filtered_ERR220426.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,180","cell_number":"6,284","ir_sequence_count":5242,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":69,"ir_subject_age_max":69,"ir_project_sample_id":286},{"_id":293,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode5.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 1 CLL\/SLL-1a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode5.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 1 CLL\/SLL","igblast_file_name":"SRR030807_filtered_barcode5.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1431","cell_number":"270691","ir_sequence_count":1428,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":293},{"_id":292,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode12.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"healthy donor 2-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode12.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"healthy donor 2","igblast_file_name":"SRR030815_filtered_barcode12.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,470","cell_number":"171714","ir_sequence_count":6442,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":292},{"_id":294,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"bone marrow","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode10.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 5 PTLD marrow infiltrate-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode10.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 5 PTLD marrow infiltrate","igblast_file_name":"SRR030807_filtered_barcode10.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7715","cell_number":"270691","ir_sequence_count":7635,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"post transplant lymphoproliferative disease, diffuse large B cell lymphoma in liver","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":294},{"_id":296,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode14.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 3-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode14.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 3","igblast_file_name":"SRR030815_filtered_barcode14.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,888","cell_number":"171714","ir_sequence_count":4865,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":296},{"_id":299,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"24","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220445.barcode13.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":" Healthy_12_barcode13","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220445.barcode13.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220445","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":" Healthy_12_barcode13","igblast_file_name":"filtered_ERR220445.barcode13.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"37,532","cell_number":"32,631","ir_sequence_count":21861,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":24,"ir_subject_age_max":24,"ir_project_sample_id":299},{"_id":302,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode18.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:10000-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode18.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:10000","igblast_file_name":"SRR030807_filtered_barcode18.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"17731","cell_number":"270691","ir_sequence_count":17524,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":302},{"_id":301,"collapsing_method":null,"collection_time_point_relative":"Day 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875297_filtered_1.fastq -r ERR875297_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875297.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"10","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875298.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"F3Cpost","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875298_aa.txz, ERR875298_ab.txz, ERR875298_ac.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875298","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 3 Carrier","igblast_file_name":"ERR875298.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,782,921","cell_number":"3,110,161","ir_sequence_count":1394920,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg carrier vaccinated","ir_subject_age_min":10,"ir_subject_age_max":10,"ir_project_sample_id":301},{"_id":303,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"58","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220400.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_2","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220400.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220400","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_2-sc-2013-01-11T14:16:16Z-1548345","igblast_file_name":"filtered_ERR220400.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"28,254","cell_number":"52,971","ir_sequence_count":30444,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":58,"ir_subject_age_max":58,"ir_project_sample_id":303},{"_id":306,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"68","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220465.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_5_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220465.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220465","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_5_8-sc-2013-01-11T14:17:29Z-1548417","igblast_file_name":"filtered_ERR220465.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5876","cell_number":"6,173","ir_sequence_count":4833,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":68,"ir_subject_age_max":68,"ir_project_sample_id":306},{"_id":307,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode17.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:1000-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode17.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:1000","igblast_file_name":"SRR030813_filtered_barcode17.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,993","cell_number":"182564","ir_sequence_count":5955,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":307},{"_id":308,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"13","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"paired_ERR875289.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"F1Cpre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875289_aa.txz, ERR875289_ab.txz, ERR875289_ac.txz, ERR875289_ad.txz, ERR875289_ae.txz, ERR875289_af.txz, ERR875289_ag.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875289","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 1 Carrier","igblast_file_name":"ERR875289.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":null,"cell_number":"4,821,880","ir_sequence_count":3111452,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg carrier unvaccinated","ir_subject_age_min":13,"ir_subject_age_max":13,"ir_project_sample_id":308},{"_id":309,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220418.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_11_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220418.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220418","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_11_7-sc-2013-01-11T14:16:36Z-1548364","igblast_file_name":"filtered_ERR220418.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9,816","cell_number":"6,564","ir_sequence_count":5942,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":309},{"_id":312,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"77","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220442.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_9_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220442.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220442","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_9_7-sc-2013-01-11T14:17:06Z-1548392","igblast_file_name":"filtered_ERR220442.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"30,218","cell_number":"6,904","ir_sequence_count":6240,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":77,"ir_subject_age_max":77,"ir_project_sample_id":312},{"_id":315,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"38","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode38.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"38","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode38.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"38","igblast_file_name":" SRR030820_filtered_barcode38.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,843","cell_number":"422073","ir_sequence_count":0,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":38,"ir_subject_age_max":38,"ir_project_sample_id":315},{"_id":317,"collapsing_method":null,"collection_time_point_relative":"Day 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875301_filtered_1.fastq -r ERR875301_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875301.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"5","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875302.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"F4NCpost","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875302_aa.txz, ERR875302_ab.txz, ERR875302_ac.txz, ERR875302_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875302","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 4 Non-carrier","igblast_file_name":"ERR875302.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,188,780","cell_number":"2,997,090","ir_sequence_count":1880567,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg non-carrier vaccinated","ir_subject_age_min":5,"ir_subject_age_max":5,"ir_project_sample_id":317},{"_id":318,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode23.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 1-3b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode23.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 1 time 14 months replicate","igblast_file_name":"SRR030813_filtered_barcode23.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,570","cell_number":"182564","ir_sequence_count":3556,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":318},{"_id":319,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"77","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220443.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_9_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220443.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220443","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_9_8-sc-2013-01-11T14:17:07Z-1548393","igblast_file_name":"filtered_ERR220443.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"53,246","cell_number":"4,214","ir_sequence_count":3530,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":77,"ir_subject_age_max":77,"ir_project_sample_id":319},{"_id":320,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode8.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 3 FL and SLL-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode8.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 3 FL and SLL","igblast_file_name":"SRR030813_filtered_barcode8.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,279","cell_number":"182564","ir_sequence_count":5261,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"small lymphocytic leukemia, follicular lymphoma","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":320},{"_id":322,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"68","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220462.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_5_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220462.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220462","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_5_5-sc-2013-01-11T14:17:27Z-1548414","igblast_file_name":"filtered_ERR220462.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,753","cell_number":"4,766","ir_sequence_count":3472,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":68,"ir_subject_age_max":68,"ir_project_sample_id":322},{"_id":325,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode20.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 1-1a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode20.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 1 time 0","igblast_file_name":"SRR030813_filtered_barcode20.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,710","cell_number":"182564","ir_sequence_count":4697,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":325},{"_id":326,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220457.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_4_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220457.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220457","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_4_6-sc-2013-01-11T14:17:21Z-1548408","igblast_file_name":"filtered_ERR220457.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,546","cell_number":"9,217","ir_sequence_count":6604,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":326},{"_id":327,"collapsing_method":null,"collection_time_point_relative":"Week 2 ","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278151_filtered_1.fastq -r ERR1278151_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278151.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"42","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278151.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A1wk2","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278151_aa.txz, ERR1278151_ab.txz, ERR1278151_ac.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278151","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 1","igblast_file_name":"ERR1278151.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,821,655","cell_number":"2,868,249","ir_sequence_count":1463721,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":42,"ir_subject_age_max":42,"ir_project_sample_id":327},{"_id":331,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode14.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 3-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode14.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 3","igblast_file_name":"SRR030807_filtered_barcode14.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"17772","cell_number":"270691","ir_sequence_count":17641,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":331},{"_id":335,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode21.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 1-1b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode21.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 1 time 0 replicate","igblast_file_name":"SRR030813_filtered_barcode21.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,443","cell_number":"182564","ir_sequence_count":3433,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":335},{"_id":334,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode4.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-3b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode4.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1 time 14 months replicate","igblast_file_name":"SRR030813_filtered_barcode4.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,459","cell_number":"182564","ir_sequence_count":3444,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":334},{"_id":337,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"bone marrow","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode10.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 5 PTLD marrow infiltrate-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode10.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 5 PTLD marrow infiltrate","igblast_file_name":"SRR030813_filtered_barcode10.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,721","cell_number":"182564","ir_sequence_count":3710,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"posttransplant lymphoproliferative disease, diffuse large B cell lymphoma in liver","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":337},{"_id":338,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":"Caucasian","sequencing_platform":"Illumina Hiseq 2000","cell_subset":"T cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"43yrs","organism":"Homo sapiens","tissue":"PBMC","collected_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","link_type":"Daughter, son","immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"TRBJ, TRBC","disease_state_sample":"Healthy","study_id":"PRJNA229070","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR1033673_split_aa.fasta, SRR1033673_split_ab.fasta, SRR1033673_split_ac.fasta, SRR1033673_split_ad.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"Mother C","lab_name":"Shemyakin-Ovchinnikov institute of Bioorganic Chemistry ","pcr_target_locus":null,"lab_address":"Russian Academy of Sciences","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":null,"complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Healthy baseline Study","ir_sra_run_id":"SRR1033673","template_amount":null,"submitted_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","mixcr_file_name":"SRR1033673_aa_mixcr.vdjca, SRR1033673_aa_mixcr_annotation.txt, SRR1033673_ab_mixcr.vdjca, SRR1033673_ab_mixcr_annotation.txt, SRR1033673_ac_mixcr.vdjca, SRR1033673_ac_mixcr_annotation.txt, SRR1033673_ad_mixcr.vdjca, SRR1033673_ad_mixcr_annotation.txt, SRR1033673_aa_mixcr.clns, SRR1033673_aa_mixcr_clones.txt, SRR1033673_ab_mixcr.clns, SRR1033673_ab_mixcr_clones.txt, SRR1033673_ac_mixcr.clns, SRR1033673_ac_mixcr_clones.txt, SRR1033673_ad_mixcr.clns, SRR1033673_ad_mixcr_clones.txt","collection_time_event":"Blood withdrawl","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Mother C","igblast_file_name":null,"intervention":null,"linked_subjects":"Child C1, Child C2","total_reads_passing_qc_filter":"13,502,141","cell_number":"11,167,059","ir_sequence_count":10063432,"forward_PCR_primer_target_location":"TRBV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mother and child T cell receptor repertoires: deep profiling study","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":43,"ir_subject_age_max":43,"cell_tissue":"PBMC","ir_project_sample_id":338},{"_id":339,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"69","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220431.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_7_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220431.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220431","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_7_8-sc-2013-01-11T14:16:52Z-1548379","igblast_file_name":"filtered_ERR220431.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,979","cell_number":"4,569","ir_sequence_count":2154,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":69,"ir_subject_age_max":69,"ir_project_sample_id":339},{"_id":343,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"PEAR (Galaxy Version, Minimum possible length of the assembled sequences=60, Minimum length of reads after trimming the low quality part=60, Quality score threshold for triming the low quality part of a read=30, All else default values","ethnicity":"Caucasian","sequencing_platform":"Illumina Hiseq 2000","cell_subset":"T cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"43yrs","organism":"Homo sapiens","tissue":"PBMC","collected_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","link_type":"Son, son","immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"TRBJ, TRBC","disease_state_sample":"Healthy","study_id":"PRJNA229070","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR1033672_split_aa.fasta, SRR1033672_split_ab.fasta, SRR1033672_split_ac.fasta, SRR1033672_split_ad.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"Mother B","lab_name":"Shemyakin-Ovchinnikov institute of Bioorganic Chemistry ","pcr_target_locus":null,"lab_address":"Russian Academy of Sciences","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":null,"complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Healthy baseline Study","ir_sra_run_id":"SRR1033672","template_amount":null,"submitted_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","mixcr_file_name":"SRR1033672_aa_mixcr.vdjca, SRR1033672_aa_mixcr_annotation.txt, SRR1033672_ab_mixcr.vdjca, SRR1033672_ab_mixcr_annotation.txt, SRR1033672_ac_mixcr.vdjca, SRR1033672_ac_mixcr_annotation.txt, SRR1033672_ad_mixcr.vdjca, SRR1033672_ad_mixcr_annotation.txt, SRR1033672_aa_mixcr.clns, SRR1033672_aa_mixcr_clones.txt, SRR1033672_ab_mixcr.clns, SRR1033672_ab_mixcr_clones.txt, SRR1033672_ac_mixcr.clns, SRR1033672_ac_mixcr_clones.txt, SRR1033672_ad_mixcr.clns, SRR1033672_ad_mixcr_clones.txt","collection_time_event":"Blood withdrawl","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Mother B","igblast_file_name":null,"intervention":null,"linked_subjects":"Child B1, Child B2","total_reads_passing_qc_filter":"1,716,035","cell_number":"13,872,805","ir_sequence_count":10399769,"forward_PCR_primer_target_location":"TRBV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mother and child T cell receptor repertoires: deep profiling study","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":43,"ir_subject_age_max":43,"cell_tissue":"PBMC","ir_project_sample_id":343},{"_id":349,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"54","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode54.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"54","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode54.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"54","igblast_file_name":" SRR030820_filtered_barcode54.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,768","cell_number":"422073","ir_sequence_count":7083,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":54,"ir_subject_age_max":54,"ir_project_sample_id":349},{"_id":350,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"64","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220433.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_8_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220433.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220433","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_8_4-sc-2013-01-11T14:16:55Z-1548382","igblast_file_name":"filtered_ERR220433.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,509","cell_number":"8,454","ir_sequence_count":5903,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":64,"ir_subject_age_max":64,"ir_project_sample_id":350},{"_id":348,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"75","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode75.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"75","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode75.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"75","igblast_file_name":" SRR030822_filtered_barcode75.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,541","cell_number":"433784","ir_sequence_count":6260,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":75,"ir_subject_age_max":75,"ir_project_sample_id":348},{"_id":353,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"24","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220445.barcode9.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_10_barcode9","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220445.barcode9.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220445","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_10_barcode9","igblast_file_name":"filtered_ERR220445.barcode9.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"22,011","cell_number":"58,793","ir_sequence_count":40328,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":24,"ir_subject_age_max":24,"ir_project_sample_id":353},{"_id":352,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode15.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:10-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode15.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:10","igblast_file_name":"SRR030815_filtered_barcode15.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,743","cell_number":"171714","ir_sequence_count":7699,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":352},{"_id":354,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220412.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_10_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220412.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220412","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_10_7-sc-2013-01-11T14:16:29Z-1548357","igblast_file_name":"filtered_ERR220412.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,825","cell_number":"11,091","ir_sequence_count":8641,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":354},{"_id":356,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode5.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 1 CLL\/SLL-1a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode5.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 1 CLL\/SLL time 0","igblast_file_name":"SRR030813_filtered_barcode5.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,183","cell_number":"182564","ir_sequence_count":6159,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":356},{"_id":357,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode27.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 3b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode27.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 14 months replicate","igblast_file_name":"SRR030815_filtered_barcode27.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,095","cell_number":"171714","ir_sequence_count":3084,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":357},{"_id":359,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"31","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode31.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"31","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode31.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"31","igblast_file_name":" SRR030820_filtered_barcode31.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,868","cell_number":"422073","ir_sequence_count":2825,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":31,"ir_subject_age_max":31,"ir_project_sample_id":359},{"_id":360,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode3.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-3a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1 time 14 months","igblast_file_name":"SRR030813_filtered_barcode3.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,307","cell_number":"182564","ir_sequence_count":5278,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":360},{"_id":361,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"44","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode44.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"44","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode44.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"44","igblast_file_name":" SRR030822_filtered_barcode44.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,562","cell_number":"433784","ir_sequence_count":2451,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":44,"ir_subject_age_max":44,"ir_project_sample_id":361},{"_id":362,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220448.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220448.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220448","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_4-sc-2013-01-11T14:17:13Z-1548399","igblast_file_name":"filtered_ERR220448.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"19,653","cell_number":"10,646","ir_sequence_count":8540,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":362},{"_id":365,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"32","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode32.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"32","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode32.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"32","igblast_file_name":" SRR030820_filtered_barcode32.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,134","cell_number":"422073","ir_sequence_count":4066,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":32,"ir_subject_age_max":32,"ir_project_sample_id":365},{"_id":366,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"38","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode38.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"38","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode38.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"38","igblast_file_name":" SRR030822_filtered_barcode38.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,877","cell_number":"433784","ir_sequence_count":0,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":38,"ir_subject_age_max":38,"ir_project_sample_id":366},{"_id":368,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875292_filtered_1.fastq -r ERR875292_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875292.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"14","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875293.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"F2NCpre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875293_aa.txz, ERR875293_ab.txz, ERR875293_ac.txz, ERR875293_ad.txz, ERR875293_ae.txz, ERR875293_af.txz, ERR875293_ag.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875293 ","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 2 Non-carrier","igblast_file_name":"ERR875293.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,260,441","cell_number":"5,891,225","ir_sequence_count":3364283,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg non-carrier unvaccinated","ir_subject_age_min":14,"ir_subject_age_max":14,"ir_project_sample_id":368},{"_id":372,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220422.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_6_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220422.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220422","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_6_5-sc-2013-01-11T14:16:42Z-1548369","igblast_file_name":"filtered_ERR220422.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9,899","cell_number":"9,640","ir_sequence_count":6065,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":372},{"_id":370,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875290_filtered_1.fastq -r ERR875290_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875290.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"11","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875291.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"F1NCpre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875291_aa.txz, ERR875291_ab.txz, ERR875291_ac.txz, ERR875291_ad.txz, ERR875291_ae.txz, ERR875291_af.txz, ERR875291_ag.txz, ERR875291_ah.txz, ERR875291_ai.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875291","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 1 Non-carrier","igblast_file_name":"ERR875291.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,111,452","cell_number":"6,353,773","ir_sequence_count":4260441,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg non-carrier unvaccinated","ir_subject_age_min":11,"ir_subject_age_max":11,"ir_project_sample_id":370},{"_id":373,"collapsing_method":null,"collection_time_point_relative":"Week 2 ","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278157_filtered_1.fastq -r ERR1278157_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278157.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"47","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278157.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A3wk2","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278157_aa.txz, ERR1278157_ab.txz, ERR1278157_ac.txz, ERR1278157_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278157 ","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 3","igblast_file_name":"ERR1278157.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,091,249","cell_number":"2,563,993","ir_sequence_count":1534270,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":47,"ir_subject_age_max":47,"ir_project_sample_id":373},{"_id":375,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"64","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220434.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_8_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220434.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220434","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_8_5-sc-2013-01-11T14:16:57Z-1548383","igblast_file_name":"filtered_ERR220434.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,411","cell_number":"4,458","ir_sequence_count":2538,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":64,"ir_subject_age_max":64,"ir_project_sample_id":375},{"_id":376,"collapsing_method":null,"collection_time_point_relative":"sampled 7\/14\/2006","sequencing_facility":null,"cell_phenotype":" CD3-, CD14-, CD19+, CD20+, IgG+, IgM-, RSC3+","paired_read_assembly":null,"ethnicity":"African","sequencing_platform":"454 Roche GS FLX","cell_subset":"Memory B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"56","organism":"Homo sapiens","tissue":"PBMC","collected_by":"T. Zhu, J. Zhou, P.D. Kwong, ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":"sample collection","medical_history":null,"reverse_PCR_primer_target_location":"C Region","disease_state_sample":"HIV+","study_id":"PRJNA195543","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR800641kappa_split1.fasta, filtered_SRR800641kappa_split2.fasta, unfiltered_SRR800641kappa_split1.fasta, unfiltered_SRR800641kappa_split2.fasta","library_construction_method":"other","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"other","study_group_description":"Case","sample_id":"NIAID 45","lab_name":"Vaccine Research Center","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"filtered_SRR800641kappa_split1.txz, filtered_SRR800641kappa_split2.txz, unfiltered_SRR800641kappa_split1.txz, unfiltered_SRR800641kappa_split2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"HIV+ Study","ir_sra_run_id":"SRR800641","template_amount":null,"submitted_by":"T. Zhu, J. Zhou, P.D. Kwong, ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"15 million","subject_id":"NIAID 45","igblast_file_name":"filtered_SRR800641kappa_split1_igblast.fmt7, filtered_SRR800641kappa_split2_igblast.fmt7, unfiltered_SRR800641kappa_split1_igblast.fmt7, unfiltered_SRR800641kappa_split2_igblast.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"663,335","cell_number":"740,419","ir_sequence_count":663335,"forward_PCR_primer_target_location":"V gene specific","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Multi-donor Analysis Reveal Structural Elements, Genetic Determinants, and Maturation Pathway for Effective HIV-1 Neutralization by VRC01-class Antibodies","pub_ids":null,"disease_diagnosis":"diagnosed 1990, HIV-1 infected clade B","ir_subject_age_min":56,"ir_subject_age_max":56,"ir_project_sample_id":376},{"_id":378,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"23","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode23.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"23","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode23.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"23","igblast_file_name":" SRR030822_filtered_barcode23.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,866","cell_number":"433784","ir_sequence_count":4819,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":23,"ir_subject_age_max":23,"ir_project_sample_id":378},{"_id":380,"collapsing_method":null,"collection_time_point_relative":"time 3 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode6.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 1 CLL\/SLL-2-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode6.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 1 CLL\/SLL time","igblast_file_name":"SRR030809_filtered_barcode6.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1116","cell_number":"251408","ir_sequence_count":1110,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":380},{"_id":383,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220411.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_10_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220411.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220411","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_10_6-sc-2013-01-11T14:16:29Z-1548356","igblast_file_name":"filtered_ERR220411.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,175","cell_number":"10,553","ir_sequence_count":8314,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":383},{"_id":384,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220420.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_6_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220420.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220420","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_6_3-sc-2013-01-11T14:16:40Z-1548367","igblast_file_name":"filtered_ERR220420.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,070","cell_number":"11,778","ir_sequence_count":9810,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":384},{"_id":386,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode9.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-c ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode9.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030817_filtered_barcode9.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,474","cell_number":"556038","ir_sequence_count":3408,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":386},{"_id":385,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"44","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode44.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"44","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode44.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"44","igblast_file_name":" SRR030820_filtered_barcode44.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,464","cell_number":"422073","ir_sequence_count":2318,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":44,"ir_subject_age_max":44,"ir_project_sample_id":385},{"_id":391,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode25.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 1b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode25.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 0 replicate","igblast_file_name":"SRR030815_filtered_barcode25.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,225","cell_number":"171714","ir_sequence_count":4197,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":391},{"_id":390,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"45","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode45b.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"45b","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode45b.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"45","igblast_file_name":" SRR030820_filtered_barcode45b.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,028","cell_number":"422073","ir_sequence_count":5389,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":45,"ir_subject_age_max":45,"ir_project_sample_id":390},{"_id":393,"collapsing_method":null,"collection_time_point_relative":"Day 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875299_filtered_1.fastq -r ERR875299_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875299.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"4","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875300.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"F3NCpost","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875300_aa.txz, ERR875300_ab.txz, ERR875300_ac.txz, ERR875300_ad.txz, ERR875300_ae.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875300","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 3 Non-carrier","igblast_file_name":"ERR875300.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,394,920","cell_number":"3,008,771","ir_sequence_count":2188780,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg non-carrier vaccinated","ir_subject_age_min":4,"ir_subject_age_max":4,"ir_project_sample_id":393},{"_id":392,"collapsing_method":null,"collection_time_point_relative":"Day 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875291_filtered_1.fastq -r ERR875291_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875291.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"11","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875292.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"F1NCpost","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875292_aa.txz, ERR875292_ab.txz, ERR875292_ac.txz, ERR875292_ad.txz, ERR875292_ae.txz, ERR875292_af.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875292","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 1 Non-carrier","igblast_file_name":"ERR875292.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,928,616","cell_number":"4,762,812","ir_sequence_count":2904961,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg non-carrier vaccinated","ir_subject_age_min":11,"ir_subject_age_max":11,"ir_project_sample_id":392},{"_id":394,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"77","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220402.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220402.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220402","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_4-sc-2013-01-11T14:16:18Z-1548347","igblast_file_name":"filtered_ERR220402.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9,782","cell_number":"40,641","ir_sequence_count":27592,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":77,"ir_subject_age_max":77,"ir_project_sample_id":394},{"_id":395,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"19","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode19.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"19","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode19.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"19","igblast_file_name":" SRR030822_filtered_barcode19.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"12,985","cell_number":"433784","ir_sequence_count":12855,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":19,"ir_subject_age_max":19,"ir_project_sample_id":395},{"_id":396,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"69","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220405.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220405.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220405","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_7-sc-2013-01-11T14:16:21Z-1548350","igblast_file_name":"filtered_ERR220405.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,779","cell_number":"7,607","ir_sequence_count":5423,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":69,"ir_subject_age_max":69,"ir_project_sample_id":396},{"_id":397,"collapsing_method":null,"collection_time_point_relative":"Day 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875303_filtered_1.fastq -r ERR875303_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875303.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"3","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875304.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"F4Cpost","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875304_aa.txz, ERR875304_ab.txz, ERR875304_ac.txz, ERR875304_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875304 ","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 4 Carrier","igblast_file_name":"ERR875304.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,880,567","cell_number":"2,966,573","ir_sequence_count":1784287,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg carrier vaccinated","ir_subject_age_min":3,"ir_subject_age_max":3,"ir_project_sample_id":397},{"_id":398,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220409.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_10_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220409.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220409","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_10_4-sc-2013-01-11T14:16:26Z-1548354","igblast_file_name":"filtered_ERR220409.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,319","cell_number":"9,405","ir_sequence_count":7415,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":398},{"_id":400,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"25","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode25.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"25","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode25.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"25","igblast_file_name":" SRR030820_filtered_barcode25.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,227","cell_number":"422073","ir_sequence_count":4169,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":25,"ir_subject_age_max":25,"ir_project_sample_id":400},{"_id":399,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"81","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220416.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_11_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220416.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220416","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_11_5-sc-2013-01-11T14:16:35Z-1548362","igblast_file_name":"filtered_ERR220416.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,952","cell_number":"2,691","ir_sequence_count":2090,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":81,"ir_subject_age_max":81,"ir_project_sample_id":399},{"_id":401,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":"Caucasian","sequencing_platform":"Illumina Hiseq 2000","cell_subset":"T cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"16yrs","organism":"Homo sapiens","tissue":"PBMC","collected_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","link_type":"Sibling, son","immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"TRBJ, TRBC","disease_state_sample":"Healthy","study_id":"PRJNA229070","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_du_SRR1033679.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"Child C2","lab_name":"Shemyakin-Ovchinnikov institute of Bioorganic Chemistry ","pcr_target_locus":null,"lab_address":" Russian Academy of Sciences","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":null,"complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Healthy baseline Study","ir_sra_run_id":"SRR1033679 ","template_amount":null,"submitted_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","mixcr_file_name":"SRR1033679_mixcr.vdjca, SRR1033679_mixcr_annotation.txt, SRR1033679_mixcr.clns, SRR1033679_mixcr_clones.txt","collection_time_event":"Blood withdrawl","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Child C2","igblast_file_name":null,"intervention":null,"linked_subjects":"Child C1, Mother C","total_reads_passing_qc_filter":"3,058,711","cell_number":"4,564,646","ir_sequence_count":3701705,"forward_PCR_primer_target_location":"TRBV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mother and child T cell receptor repertoires: deep profiling study","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":16,"ir_subject_age_max":16,"cell_tissue":"PBMC","ir_project_sample_id":401},{"_id":403,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220423.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_6_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220423.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220423","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_6_6-sc-2013-01-11T14:16:43Z-1548370","igblast_file_name":"filtered_ERR220423.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,369","cell_number":"11,197","ir_sequence_count":8761,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":403},{"_id":406,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode19.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:100000-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode19.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:100000","igblast_file_name":"SRR030809_filtered_barcode19.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"16384","cell_number":"251408","ir_sequence_count":16113,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":406},{"_id":407,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"55","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode55.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"55","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode55.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"55","igblast_file_name":" SRR030820_filtered_barcode55.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,217","cell_number":"422073","ir_sequence_count":5645,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":55,"ir_subject_age_max":55,"ir_project_sample_id":407},{"_id":408,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode8.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-b ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode8.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030816_filtered_barcode8.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,842","cell_number":"635307","ir_sequence_count":4805,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":408},{"_id":409,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode4.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-d","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode4.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030817_filtered_barcode4.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,816","cell_number":"556038","ir_sequence_count":1807,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":409},{"_id":410,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"69","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220429.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_7_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220429.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220429","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_7_6-sc-2013-01-11T14:16:50Z-1548377","igblast_file_name":"filtered_ERR220429.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,160","cell_number":"4,878","ir_sequence_count":3312,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":69,"ir_subject_age_max":69,"ir_project_sample_id":410},{"_id":411,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode8.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-b ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode8.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030817_filtered_barcode8.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,254","cell_number":"556038","ir_sequence_count":4211,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":411},{"_id":413,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"50","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode50.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"50","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode50.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"50","igblast_file_name":" SRR030820_filtered_barcode50.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,211","cell_number":"422073","ir_sequence_count":4950,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":50,"ir_subject_age_max":50,"ir_project_sample_id":413},{"_id":414,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR875296_filtered_1.fastq -r ERR875296_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR875296.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"10","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Hepatitis B","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR875297.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"F3Cpre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR875297_aa.txz, ERR875297_ab.txz, ERR875297_ac.txz, ERR875297_ad.txz, ERR875297_ae.txz, ERR875297_af.txz, ERR875297_ag.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR875297 ","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Family 3 Carrier","igblast_file_name":"ERR875297.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,261,822","cell_number":"4,490,360","ir_sequence_count":3400216,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"HBeAg carrier unvaccinated","ir_subject_age_min":10,"ir_subject_age_max":10,"ir_project_sample_id":414},{"_id":415,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode18.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:10000-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode18.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:10000","igblast_file_name":"SRR030815_filtered_barcode18.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,373","cell_number":"171714","ir_sequence_count":5350,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":415},{"_id":416,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220456.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_4_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220456.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220456","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_4_5-sc-2013-01-11T14:17:20Z-1548407","igblast_file_name":"filtered_ERR220456.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,925","cell_number":"5,291","ir_sequence_count":3366,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":416},{"_id":418,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"35","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode35.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"35","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode35.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"35","igblast_file_name":" SRR030822_filtered_barcode35.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,765","cell_number":"433784","ir_sequence_count":3726,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":35,"ir_subject_age_max":35,"ir_project_sample_id":418},{"_id":419,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"35","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode35.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"35","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode35.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"35","igblast_file_name":" SRR030820_filtered_barcode35.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,690","cell_number":"422073","ir_sequence_count":3621,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":35,"ir_subject_age_max":35,"ir_project_sample_id":419},{"_id":423,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220459.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_4_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220459.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220459","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_4_8-sc-2013-01-11T14:17:23Z-1548410","igblast_file_name":"filtered_ERR220459.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,619","cell_number":"7,468","ir_sequence_count":5462,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":423},{"_id":429,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"24","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220445.barcode7.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_13_barcode7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220445.barcode7.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220445","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_13_barcode7","igblast_file_name":"filtered_ERR220445.barcode7.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"25,311","cell_number":"211,723","ir_sequence_count":123281,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":24,"ir_subject_age_max":24,"ir_project_sample_id":429},{"_id":430,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"20","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298730.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"14711_PBMC","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298730.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298730 ","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"14711_PBMC","igblast_file_name":"filtered_SRR1298730.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,855,317","cell_number":null,"ir_sequence_count":141696,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":20,"ir_subject_age_max":20,"ir_project_sample_id":430},{"_id":431,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode11.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-e ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode11.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030817_filtered_barcode11.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,085","cell_number":"556038","ir_sequence_count":3039,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":431},{"_id":432,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode11.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-e ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode11.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030816_filtered_barcode11.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,378","cell_number":"635307","ir_sequence_count":3332,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":432},{"_id":434,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"54","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode54.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"54","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode54.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"54","igblast_file_name":" SRR030822_filtered_barcode54.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,911","cell_number":"433784","ir_sequence_count":7168,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":54,"ir_subject_age_max":54,"ir_project_sample_id":434},{"_id":435,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode3.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-c","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030816_filtered_barcode3.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,547","cell_number":"635307","ir_sequence_count":3534,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":435},{"_id":436,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode17.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:1000-b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode17.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:1000","igblast_file_name":"SRR030815_filtered_barcode17.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,751","cell_number":"171714","ir_sequence_count":5711,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":436},{"_id":437,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode28.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 3c2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode28.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 14 months replicate","igblast_file_name":"SRR030815_filtered_barcode28.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,952","cell_number":"171714","ir_sequence_count":3930,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":437},{"_id":439,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode19.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:100000-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode19.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:100000","igblast_file_name":"SRR030813_filtered_barcode19.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,558","cell_number":"182564","ir_sequence_count":4536,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":439},{"_id":440,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"45","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode45b.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"45b","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode45b.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"45","igblast_file_name":" SRR030822_filtered_barcode45b.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,098","cell_number":"433784","ir_sequence_count":5265,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":45,"ir_subject_age_max":45,"ir_project_sample_id":440},{"_id":442,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"68","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220461.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_5_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220461.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220461","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_5_4-sc-2013-01-11T14:17:26Z-1548413","igblast_file_name":"filtered_ERR220461.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,692","cell_number":"6,826","ir_sequence_count":5526,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":68,"ir_subject_age_max":68,"ir_project_sample_id":442},{"_id":446,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"34","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298734.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"30512_CSF","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298734.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298734 ","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"30512_CSF","igblast_file_name":"filtered_SRR1298734.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4854","cell_number":null,"ir_sequence_count":17960,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":34,"ir_subject_age_max":34,"ir_project_sample_id":446},{"_id":447,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode9.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 4 CLL\/SLL-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode9.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 4 CLL\/SLL","igblast_file_name":"SRR030809_filtered_barcode9.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"17999","cell_number":"251408","ir_sequence_count":17811,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":447},{"_id":449,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030817_filtered_barcode10.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-d ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030817_filtered_barcode10.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030817","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030817_filtered_barcode10.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,145","cell_number":"556038","ir_sequence_count":3033,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":449},{"_id":452,"collapsing_method":null,"collection_time_point_relative":"time 3 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode6.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 1 CLL\/SLL-2a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode6.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 1 CLL\/SLL time","igblast_file_name":"SRR030807_filtered_barcode6.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1196","cell_number":"270691","ir_sequence_count":1194,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":452},{"_id":453,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode19.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:100000-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode19.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:100000","igblast_file_name":"SRR030807_filtered_barcode19.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"17595","cell_number":"270691","ir_sequence_count":17355,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":453},{"_id":455,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"77","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220441.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_9_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220441.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220441","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_9_6-sc-2013-01-11T14:17:04Z-1548391","igblast_file_name":"filtered_ERR220441.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,538","cell_number":"5,576","ir_sequence_count":5034,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":77,"ir_subject_age_max":77,"ir_project_sample_id":455},{"_id":454,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode2.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-1b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode2.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1 time 0 replicate","igblast_file_name":"SRR030813_filtered_barcode2.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,659","cell_number":"182564","ir_sequence_count":4645,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":454},{"_id":456,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"77","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220407.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_9","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220407.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220407","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_9-sc-2013-01-11T14:16:24Z-1548352","igblast_file_name":"filtered_ERR220407.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"7,430","cell_number":"7,427","ir_sequence_count":6766,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":77,"ir_subject_age_max":77,"ir_project_sample_id":456},{"_id":457,"collapsing_method":null,"collection_time_point_relative":"Week 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278156_filtered_1.fastq -r ERR1278156_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278156.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"47","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278156.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A3wk1","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278156_aa.txz, ERR1278156_ab.txz, ERR1278156_ac.txz, ERR1278156_ad.txz, ERR1278156_ae.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278156","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 3","igblast_file_name":"ERR1278156.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,199,488","cell_number":"2,408,132","ir_sequence_count":2148806,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":47,"ir_subject_age_max":47,"ir_project_sample_id":457},{"_id":459,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"24","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220445.barcode5.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_12_barcode5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220445.barcode5.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220445","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_12_barcode5","igblast_file_name":"filtered_ERR220445.barcode5.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"40,931","cell_number":"66,266","ir_sequence_count":42410,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":24,"ir_subject_age_max":24,"ir_project_sample_id":459},{"_id":463,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220425.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_6_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220425.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220425","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_6_8-sc-2013-01-11T14:16:45Z-1548372","igblast_file_name":"filtered_ERR220425.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,407","cell_number":"9,567","ir_sequence_count":7347,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":463},{"_id":467,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"70","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode70.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"70","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode70.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"70","igblast_file_name":" SRR030822_filtered_barcode70.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,325","cell_number":"433784","ir_sequence_count":8198,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":70,"ir_subject_age_max":70,"ir_project_sample_id":467},{"_id":468,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"31","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298740.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"43113_CSF","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298740.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298740","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"43113_CSF","igblast_file_name":"filtered_SRR1298740.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"13811","cell_number":null,"ir_sequence_count":5840,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":31,"ir_subject_age_max":31,"ir_project_sample_id":468},{"_id":469,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode5.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL A-e","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode5.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL A","igblast_file_name":" SRR030816_filtered_barcode5.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,145","cell_number":"635307","ir_sequence_count":1141,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":469},{"_id":470,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode16.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:100-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode16.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:100","igblast_file_name":"SRR030813_filtered_barcode16.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,449","cell_number":"182564","ir_sequence_count":5424,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":470},{"_id":471,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"23","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220452.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_8","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220452.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220452","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_8-sc-2013-01-11T14:17:17Z-1548403","igblast_file_name":"filtered_ERR220452.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"9,320","cell_number":"40,467","ir_sequence_count":27102,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":23,"ir_subject_age_max":23,"ir_project_sample_id":471},{"_id":472,"collapsing_method":null,"collection_time_point_relative":"Week 1","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278159_filtered_1.fastq -r ERR1278159_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278159.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"37","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278159.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A4wk1","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278159_aa.txz, ERR1278159_ab.txz, ERR1278159_ac.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278159","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 4","igblast_file_name":"ERR1278159.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,534,270","cell_number":"2,820,131","ir_sequence_count":1493227,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":37,"ir_subject_age_max":37,"ir_project_sample_id":472},{"_id":473,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"25","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220453.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_9","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220453.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220453","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_9-sc-2013-01-11T14:17:18Z-1548404","igblast_file_name":"filtered_ERR220453.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,866","cell_number":"29,786","ir_sequence_count":18101,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":25,"ir_subject_age_max":25,"ir_project_sample_id":473},{"_id":475,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"20","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298731.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"14711_CSF","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298731.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298731","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"14711_CSF","igblast_file_name":"filtered_SRR1298731.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"179282","cell_number":null,"ir_sequence_count":20488,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":20,"ir_subject_age_max":20,"ir_project_sample_id":475},{"_id":476,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278158_filtered_1.fastq -r ERR1278158_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278158.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"37","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278158.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A4pre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278158_aa.txz, ERR1278158_ab.txz, ERR1278158_ac.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278158","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 4","igblast_file_name":"ERR1278158.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"2,148,806","cell_number":"2,041,832","ir_sequence_count":1420729,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":37,"ir_subject_age_max":37,"ir_project_sample_id":476},{"_id":480,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode24.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 1a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode24.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 0","igblast_file_name":"SRR030815_filtered_barcode24.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,061","cell_number":"171714","ir_sequence_count":4040,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":480},{"_id":481,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode26.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 3a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode26.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 14 months","igblast_file_name":"SRR030813_filtered_barcode26.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,935","cell_number":"182564","ir_sequence_count":3919,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":481},{"_id":483,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":"CD19, IgD, CD27","paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"31","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Palanichamy, Apeltsin et al ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Multiple Sclerosis","study_id":"PRJNA248411","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_SRR1298741.fasta","library_construction_method":"RT-PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Case","sample_id":"43113_PBMC","lab_name":"Von Budingen Lab","pcr_target_locus":null,"lab_address":"University of California San Francisco (UCSF)","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR1298741.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Multiple Sclerosis Study","ir_sra_run_id":"SRR1298741 ","template_amount":null,"submitted_by":"Palanichamy, Apeltsin et al ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^9","subject_id":"43113_PBMC","igblast_file_name":"filtered_SRR1298741.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"162264","cell_number":null,"ir_sequence_count":177810,"forward_PCR_primer_target_location":"IGHV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Immunoglobulin repertoire in multiple sclerosis","pub_ids":null,"disease_diagnosis":"Multiple Sclerosis","ir_subject_age_min":31,"ir_subject_age_max":31,"ir_project_sample_id":483},{"_id":484,"collapsing_method":null,"collection_time_point_relative":"Day 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278152_filtered_1.fastq -r ERR1278152_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278152.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"35","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278152.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A2pre","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278152_aa.txz, ERR1278152_ab.txz, ERR1278152_ac.txz, ERR1278152_ad.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278152","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 2","igblast_file_name":"ERR1278152.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,951,899","cell_number":"3,894,726","ir_sequence_count":1581000,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":35,"ir_subject_age_max":35,"ir_project_sample_id":484},{"_id":485,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"69","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220427.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_7_4","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220427.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220427","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_7_4-sc-2013-01-11T14:16:48Z-1548375","igblast_file_name":"filtered_ERR220427.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,352","cell_number":"4,864","ir_sequence_count":2393,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":69,"ir_subject_age_max":69,"ir_project_sample_id":485},{"_id":486,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"23","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220451.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220451.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220451","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_7-sc-2013-01-11T14:17:16Z-1548402","igblast_file_name":"filtered_ERR220451.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"18,311","cell_number":"31,957","ir_sequence_count":20917,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":23,"ir_subject_age_max":23,"ir_project_sample_id":486},{"_id":489,"collapsing_method":null,"collection_time_point_relative":"Week 2 ","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":"pear -f ERR1278154_filtered_1.fastq -r ERR1278154_filtered_2.fastq -n 60 -t 60 -q 25 -o paired_ERR1278154.fastq","ethnicity":null,"sequencing_platform":"Illumina NextSeq","cell_subset":"Naive B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"35","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Chang, Y.H., Kuan, H.C.","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB9332","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"paired_ERR1278154.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"A2wk2","lab_name":"Institute of Molecular and Genomic Medicine, National Health Research Institutes","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR1278154_aa.txz, ERR1278154_ab.txz, ERR1278154_ac.txz, ERR1278154_ad.txz, ERR1278154_ae.txz, ERR1278154_af.txz, ERR1278154_ag.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Hepatitis B Study","ir_sra_run_id":"ERR1278154","template_amount":null,"submitted_by":"Chang, Y.H., Kuan, H.C.","mixcr_file_name":null,"collection_time_event":"Vaccination","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Adult 2","igblast_file_name":"ERR1278154.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1,581,000","cell_number":"5,123,678","ir_sequence_count":3199488,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network Signatures of IgG Immune Repertoires in Hepatitis B Associated Chronic Infection and Vaccination Responses.","pub_ids":null,"disease_diagnosis":"Healthy Vaccinated with HBV","ir_subject_age_min":35,"ir_subject_age_max":35,"ir_project_sample_id":489},{"_id":490,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode5.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 1 CLL\/SLL-1b2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode5.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 1 CLL\/SLL time 0","igblast_file_name":"SRR030815_filtered_barcode5.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5,799","cell_number":"171714","ir_sequence_count":5769,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":490},{"_id":491,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220454.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_4_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220454.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220454","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_4_3-sc-2013-01-11T14:17:18Z-1548405","igblast_file_name":"filtered_ERR220454.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,413","cell_number":"11,092","ir_sequence_count":9173,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":491},{"_id":493,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode7.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 2 FL-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode7.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 2 FL","igblast_file_name":"SRR030809_filtered_barcode7.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5585","cell_number":"251408","ir_sequence_count":5554,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"follicular lymphoma","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":493},{"_id":495,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"68","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030822_filtered_barcode68.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"68","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030822_filtered_barcode68.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030822","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"68","igblast_file_name":" SRR030822_filtered_barcode68.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,297","cell_number":"433784","ir_sequence_count":9693,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":68,"ir_subject_age_max":68,"ir_project_sample_id":495},{"_id":496,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode24.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 2 1a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode24.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 2 time 0","igblast_file_name":"SRR030813_filtered_barcode24.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,346","cell_number":"182564","ir_sequence_count":4319,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":496},{"_id":499,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"23","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode23.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"23","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode23.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"23","igblast_file_name":" SRR030820_filtered_barcode23.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,696","cell_number":"422073","ir_sequence_count":4617,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":23,"ir_subject_age_max":23,"ir_project_sample_id":499},{"_id":501,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode3.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-3a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode3.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1","igblast_file_name":"SRR030809_filtered_barcode3.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"11830","cell_number":"251408","ir_sequence_count":11689,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":501},{"_id":500,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"69","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220428.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_7_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220428.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220428","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_7_5-sc-2013-01-11T14:16:49Z-1548376","igblast_file_name":"filtered_ERR220428.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,726","cell_number":"2,576","ir_sequence_count":1157,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":69,"ir_subject_age_max":69,"ir_project_sample_id":500},{"_id":503,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode15.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 6 CLL diluted 1:10-b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode15.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 6 CLL diluted 1:10","igblast_file_name":"SRR030809_filtered_barcode15.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8098","cell_number":"251408","ir_sequence_count":8014,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia into healthy control dilution for testing sequencing sensitivity","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":503},{"_id":505,"collapsing_method":null,"collection_time_point_relative":"time 0 and time 14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"79","organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":" SRR030820_filtered_barcode79.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"79","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030820_filtered_barcode79.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030820","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"79","igblast_file_name":" SRR030820_filtered_barcode79.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,755,737","cell_number":"422073","ir_sequence_count":4831,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":79,"ir_subject_age_max":79,"ir_project_sample_id":505},{"_id":504,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode7.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 2 FL-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode7.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 2 FL","igblast_file_name":"SRR030807_filtered_barcode7.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"5939","cell_number":"270691","ir_sequence_count":5916,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"follicular lymphoma","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":504},{"_id":507,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"68","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220463.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_5_6","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220463.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220463","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_5_6-sc-2013-01-11T14:17:28Z-1548415","igblast_file_name":"filtered_ERR220463.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,899","cell_number":"7,914","ir_sequence_count":6585,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":68,"ir_subject_age_max":68,"ir_project_sample_id":507},{"_id":506,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode5.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 1 CLL\/SLL-1b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode5.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 1 CLL\/SLL ","igblast_file_name":"SRR030809_filtered_barcode5.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"1278","cell_number":"251408","ir_sequence_count":1274,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":506},{"_id":508,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"68","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220449.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_5","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220449.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220449","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_5-sc-2013-01-11T14:17:14Z-1548400","igblast_file_name":"filtered_ERR220449.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"21,389","cell_number":"9,138","ir_sequence_count":7684,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":68,"ir_subject_age_max":68,"ir_project_sample_id":508},{"_id":511,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":"Caucasian","sequencing_platform":"Illumina Hiseq 2000","cell_subset":"T cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"6yrs","organism":"Homo sapiens","tissue":"PBMC","collected_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","link_type":"Sibling, daughter","immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"TRBJ, TRBC","disease_state_sample":"Healthy","study_id":"PRJNA229070","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_du_SRR1033678.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Transcriptomic","study_group_description":"Control","sample_id":"Child C1","lab_name":"Shemyakin-Ovchinnikov institute of Bioorganic Chemistry ","pcr_target_locus":null,"lab_address":"Russian Academy of Sciences","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":null,"complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Healthy baseline Study","ir_sra_run_id":"SRR1033678","template_amount":null,"submitted_by":"E.V. Putinseva, O.V. Britanova, D.M. Chudakov","mixcr_file_name":"SRR1033678_mixcr.vdjca, SRR1033678_mixcr_annotation.txt, SRR1033678_mixcr.clns, SRR1033678_mixcr_clones.txt","collection_time_event":"Blood withdrawl","read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Child C1","igblast_file_name":null,"intervention":null,"linked_subjects":"Child C2, Mother C","total_reads_passing_qc_filter":"3,697,002","cell_number":"6,081,365","ir_sequence_count":4867547,"forward_PCR_primer_target_location":"TRBV","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Mother and child T cell receptor repertoires: deep profiling study","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":6,"ir_subject_age_max":6,"cell_tissue":"PBMC","ir_project_sample_id":511},{"_id":514,"collapsing_method":null,"collection_time_point_relative":"time 0","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode1.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-1a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode1.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1","igblast_file_name":"SRR030809_filtered_barcode1.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8866","cell_number":"251408","ir_sequence_count":8756,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":514},{"_id":516,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode12.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"healthy donor 2-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode12.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"healthy donor 2","igblast_file_name":"SRR030807_filtered_barcode12.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"13219","cell_number":"270691","ir_sequence_count":13085,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":516},{"_id":515,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030809_filtered_barcode4.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Healthy donor 1-3b1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030809_filtered_barcode4.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030809","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Healthy donor 1","igblast_file_name":"SRR030809_filtered_barcode4.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"10540","cell_number":"251408","ir_sequence_count":10411,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":515},{"_id":517,"collapsing_method":null,"collection_time_point_relative":null,"sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"SRR030807_filtered_barcode9.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 4 CLL\/SLL-a1","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030807_filtered_barcode9.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030807","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 4 CLL\/SLL","igblast_file_name":"SRR030807_filtered_barcode9.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"19687","cell_number":"270691","ir_sequence_count":19510,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia\/small lymphocytic leukemia","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":517},{"_id":518,"collapsing_method":null,"collection_time_point_relative":"14 months","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"blood","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Healthy","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030815_filtered_barcode22.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Control","sample_id":"Experiment 2 Healthy donor 1-3a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030815_filtered_barcode22.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030815","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Exp2 only Healthy donor 1 time 14 months","igblast_file_name":"SRR030815_filtered_barcode22.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"4,293","cell_number":"171714","ir_sequence_count":4262,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":-1,"ir_subject_age_max":9999,"cell_tissue":"blood","ir_project_sample_id":518},{"_id":519,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"77","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":30,"prior_therapies":null,"fasta_file_name":"filtered_ERR220397.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_1","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220397.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220397","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_1-sc-2013-01-11T14:16:10Z-1548342","igblast_file_name":"filtered_ERR220397.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"6,331","cell_number":"55,268","ir_sequence_count":33536,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":77,"ir_subject_age_max":77,"ir_project_sample_id":519},{"_id":521,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"liver","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Lymphoma","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":"SRR030813_filtered_barcode11.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"Patient 5 PTLD liver DLBCL-a2","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"SRR030813_filtered_barcode11.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030813","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"Patient 5 PTLD liver DLBCL","igblast_file_name":"SRR030813_filtered_barcode11.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,476","cell_number":"182564","ir_sequence_count":3345,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"posttransplant lymphoproliferative disease, diffuse large B cell lymphoma in liver","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":521},{"_id":523,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX","cell_subset":"B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":null,"organism":"Homo sapiens","tissue":"diagnostic lymph node","collected_by":"Boyd S.D, Marshall E.L ","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":null,"disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":null,"sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":null,"prior_therapies":null,"fasta_file_name":" SRR030816_filtered_barcode10.fasta","library_construction_method":"PCR","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"genomic","study_group_description":"Case","sample_id":"CLL B-d ","lab_name":"Department of Pathology, Stanford University","pcr_target_locus":null,"lab_address":"Stanford University","sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":" SRR030816_filtered_barcode10.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"SRR030816","template_amount":null,"submitted_by":"Boyd S.D, Marshall E.L ","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":null,"subject_id":"CLL B ","igblast_file_name":" SRR030816_filtered_barcode10.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"3,499","cell_number":"635307","ir_sequence_count":3424,"forward_PCR_primer_target_location":"J chain and VH chain","physical_linkage":null,"sex":null,"synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"DNA","study_title":"Measurement and Clinical Monitoring of Human Lymphocyte Clonality by Massively Parallel V-D-J Pyrosequencing","pub_ids":null,"disease_diagnosis":"CLL, had undergone total lymphoid irradiation, antithymocyte glboun therapy followed by HLA-identical allogenic peripheral progenitor cell blood transplantation","ir_subject_age_min":-1,"ir_subject_age_max":9999,"ir_project_sample_id":523},{"_id":525,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"67","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser, 2013","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Healthy","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220458.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Control","sample_id":"Healthy_4_7","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220458.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220458","template_amount":null,"submitted_by":"Bashford-Rogers, Palser, 2013","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"Healthy_4_7-sc-2013-01-11T14:17:22Z-1548409","igblast_file_name":"filtered_ERR220458.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"8,225","cell_number":"10,610","ir_sequence_count":7850,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"F","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Healthy","ir_subject_age_min":67,"ir_subject_age_max":67,"ir_project_sample_id":525},{"_id":526,"collapsing_method":null,"collection_time_point_relative":"one","sequencing_facility":null,"cell_phenotype":null,"paired_read_assembly":null,"ethnicity":null,"sequencing_platform":"454 GS FLX Titanium","cell_subset":"Mature B cell","sequencing_kit":null,"germline_database":null,"ir_subject_age":"78","organism":"Homo sapiens","tissue":"PBMC","collected_by":"Bashford-Rogers, Palser","link_type":null,"immunogen":null,"cell_storage":null,"age_event":null,"medical_history":null,"reverse_PCR_primer_target_location":"J gene","disease_state_sample":"Chronic Lymphocytic Leukemia","study_id":"PRJEB1289","sequencing_run_date":null,"grants":null,"single_cell":null,"software_versions":null,"template_quality":null,"race":null,"cell_isolation":null,"tissue_processing":null,"quality_thresholds":25,"prior_therapies":null,"fasta_file_name":"filtered_ERR220401.fasta","library_construction_method":"Random","data_processing_protocols":null,"library_generation_protocol":null,"biomaterial_provider":null,"disease_stage":null,"library_source":"Genomic","study_group_description":"Case","sample_id":"CLL_3","lab_name":"The Wellcome Trust Sanger Institute","pcr_target_locus":null,"lab_address":null,"sequencing_run_id":null,"primer_match_cutoffs":null,"anatomic_site":null,"imgt_file_name":"ERR220401.txz","complete_sequences":null,"strain_name":null,"library_generation_kit_version":null,"cell_quality":null,"cell_processing_protocol":null,"study_description":"Cancer Study","ir_sra_run_id":"ERR220401","template_amount":null,"submitted_by":"Bashford-Rogers, Palser","mixcr_file_name":null,"collection_time_event":null,"read_length":null,"ancestry_population":null,"cells_per_reaction":"1*10^6","subject_id":"CLL_3-sc-2013-01-11T14:16:17Z-1548346","igblast_file_name":"filtered_ERR220401.fmt7","intervention":null,"linked_subjects":null,"total_reads_passing_qc_filter":"26,287","cell_number":"36,184","ir_sequence_count":25403,"forward_PCR_primer_target_location":"V gene","physical_linkage":null,"sex":"M","synthetic":null,"inclusion_exclusion_criteria":null,"sample_type":null,"disease_length":null,"template_class":"cDNA","study_title":"Network properties derived from deep sequencing of human B-cell receptor repertoires delineate B-cell populations","pub_ids":null,"disease_diagnosis":"Chronic lymphocytic leukemia","ir_subject_age_min":78,"ir_subject_age_max":78,"ir_project_sample_id":526},{"_id":528,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_4_4.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":84,"ir_max_age":48,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN9","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":48,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"LN9","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":1119,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":48,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":1119,"collection_time_point_relative":"one","tissue":"Right Inguinal lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":528},{"_id":529,"pub_ids":"PMC4042156","quality_thresholds":null,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":24,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":null,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":529},{"_id":530,"pub_ids":"PMC4042156","quality_thresholds":null,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":26,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":null,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":530},{"_id":531,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_2_8.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":29,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":194,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":194,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":531},{"_id":532,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_9_9.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":92,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"MALT-L 3-2","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"MALT-L, stomach lymphoma involving the mucosa and submucosa. The surface epithelium is ulcerated. Histology:MATL-L","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"MALT-L 3","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":115,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":115,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":532},{"_id":533,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":57,"ir_max_age":null,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori Subject 2-2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":null,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori ","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":null,"subject_id":"Gastritis (-) H.pylori Subject 2","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":null,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":0,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":533},{"_id":534,"pub_ids":"PMC4042156","quality_thresholds":null,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":30,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":null,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":534},{"_id":535,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_9_9.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":94,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"MALT-L 3-2","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"MALT-L, stomach lymphoma involving the mucosa and submucosa. The surface epithelium is ulcerated. Histology:MATL-L","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"MALT-L 3","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":168,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":168,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":535},{"_id":536,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_9_9.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":93,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"MALT-L 3-2","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"MALT-L, stomach lymphoma involving the mucosa and submucosa. The surface epithelium is ulcerated. Histology:MATL-L","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"MALT-L 3","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":163,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":163,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":536},{"_id":537,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_1_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":52,"ir_max_age":null,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori Subject 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":null,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori ","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":null,"subject_id":"Gastritis (-) H.pylori Subject 1","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":1598,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":null,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":1598,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":537},{"_id":538,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_5_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":13,"ir_max_age":61,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":61,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach localized large cell lymphoma with ulceration and associated severe chronic and acute inflammation, fibrosis and peritonitis","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"DLBCL 3","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":193,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":61,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":193,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":538},{"_id":539,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_4_9.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":25,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":53,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":53,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":539},{"_id":540,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":69,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 3-2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, Chronic active gastritis with H.pylori and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (+) H.pylori 3","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":0,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":540},{"_id":541,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_2_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":81,"ir_max_age":63,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN11","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":63,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"fever of unknown origin, lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"LN11","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":212,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":63,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":212,"collection_time_point_relative":"one","tissue":"Left axillary lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":541},{"_id":542,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_5_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":38,"ir_max_age":50,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":50,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , Gastric ulcer, chronic active gastritis","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (-) H.pylori 3","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":92,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":50,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":92,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":542},{"_id":543,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_5_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":71,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 3-3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, Chronic active gastritis with H.pylori and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (+) H.pylori 3","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":143,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":143,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":543},{"_id":544,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_2_2.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":48,"ir_max_age":65,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 5","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":65,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori, nodular gastric mucosa. Chronic gastritis and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (-) H.pylori 5","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":848,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":65,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":848,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":544},{"_id":545,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":18,"ir_max_age":47,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":47,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Ulcerated tumor composed by round cells invading the muscular coats and reaching the serosa. The histologic pictures favour a large cell lymphoma","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"DLBCL 2","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":47,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":0,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":545},{"_id":547,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_3_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":41,"ir_max_age":52,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 4","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":52,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , gastric polyps. Focal acute and chronic gastritis and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (-) H.pylori 4","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":82,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":52,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":82,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":547},{"_id":546,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_6_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":88,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"MALT-L 2-1","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"MALT-L. S\/P treatment for MALT-L gastric erosion. Histology:lymphoma","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"MALT-L 2","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":298,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":298,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":546},{"_id":549,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":66,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 3-1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, Chronic active gastritis with H.pylori and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (+) H.pylori 3","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":0,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":549},{"_id":548,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_3_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":61,"ir_max_age":25,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":25,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, acute and chronic gastritis-equivocal presence of H.pylor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (+) H.pylori 1","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":337,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":25,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":337,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":548},{"_id":550,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":36,"ir_max_age":30,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":30,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , normal gastric mucosa, mild chronic gastritis","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (-) H.pylori 1","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":30,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":0,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":550},{"_id":551,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_4_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":58,"ir_max_age":null,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori Subject 2-2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":null,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori ","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":null,"subject_id":"Gastritis (-) H.pylori Subject 2","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":763,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":null,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":763,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":551},{"_id":552,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_5_4.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":19,"ir_max_age":47,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":47,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Ulcerated tumor composed by round cells invading the muscular coats and reaching the serosa. The histologic pictures favour a large cell lymphoma","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"DLBCL 2","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":495,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":47,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":495,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":552},{"_id":554,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":54,"ir_max_age":null,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori Subject 2-1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":null,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori ","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":null,"subject_id":"Gastritis (-) H.pylori Subject 2","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":null,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":0,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":554},{"_id":553,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_1_1.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":62,"ir_max_age":66,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":66,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, chronis active gastritis with numerous plasma cells, H.pylori positive","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (+) H.pylori 2","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":501,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":66,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":501,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":553},{"_id":555,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_6_4.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":22,"ir_max_age":89,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 5","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":89,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Biopsy from gastric mass smooth muscle infiltrated by a predominantly large B cell lymphoma with numerous mitoses. Profile rating cell nuclear antigen is positive in 80-90% of the tumor cells","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"DLBCL 5","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":1795,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":89,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":1795,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":555},{"_id":557,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_5_2.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":79,"ir_max_age":44,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN8","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":44,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Axillary lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"LN8","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":271,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":44,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":271,"collection_time_point_relative":"one","tissue":"Left axillary lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":557},{"_id":556,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_2_8.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":31,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":341,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":341,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":556},{"_id":558,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_5_4.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":17,"ir_max_age":47,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":47,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Ulcerated tumor composed by round cells invading the muscular coats and reaching the serosa. The histologic pictures favour a large cell lymphoma","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"DLBCL 2","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":231,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":47,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":231,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":558},{"_id":559,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_5_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":11,"ir_max_age":61,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":61,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach localized large cell lymphoma with ulceration and associated severe chronic and acute inflammation, fibrosis and peritonitis","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"DLBCL 3","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":140,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":61,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":140,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":559},{"_id":560,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_6_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":86,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"MALT-L 2-1","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"MALT-L. S\/P treatment for MALT-L gastric erosion. Histology:lymphoma","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"MALT-L 2","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":172,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":172,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":560},{"_id":561,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_3_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":59,"ir_max_age":25,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":25,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, acute and chronic gastritis-equivocal presence of H.pylor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (+) H.pylori 1","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":213,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":25,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":213,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":561},{"_id":563,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_5_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":73,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 3-3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, Chronic active gastritis with H.pylori and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (+) H.pylori 3","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":228,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":228,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":563},{"_id":562,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_2_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":35,"ir_max_age":30,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":30,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , normal gastric mucosa, mild chronic gastritis","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (-) H.pylori 1","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":16,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":30,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":16,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":562},{"_id":564,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_1_1.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":64,"ir_max_age":66,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":66,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, chronis active gastritis with numerous plasma cells, H.pylori positive","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (+) H.pylori 2","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":811,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":66,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":811,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":564},{"_id":565,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_1_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":14,"ir_max_age":34,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":34,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Partial gastrectomy-lymphoma, large cell type, and the tumor is limited to the mucosa","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 1","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":97,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":34,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":97,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":565},{"_id":566,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_3_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":60,"ir_max_age":25,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":25,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, acute and chronic gastritis-equivocal presence of H.pylor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (+) H.pylori 1","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":249,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":25,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":249,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":566},{"_id":567,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_5_8.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":32,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-4","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":156,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":156,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":567},{"_id":568,"pub_ids":"PMC4042156","quality_thresholds":null,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":33,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-4","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":null,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":568},{"_id":569,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_3_2.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":76,"ir_max_age":54,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN10","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":54,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Axillary lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"LN10","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":1,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":54,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":1,"collection_time_point_relative":"one","tissue":"Right Axillary Lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":569},{"_id":570,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_6_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":67,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 3-1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, Chronic active gastritis with H.pylori and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (+) H.pylori 3","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":1713,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":1713,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":570},{"_id":571,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_3_2.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":74,"ir_max_age":54,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN10","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":54,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Axillary lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"LN10","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":110,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":54,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":110,"collection_time_point_relative":"one","tissue":"Right Axillary Lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":571},{"_id":572,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_5_1.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":68,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 3-2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, Chronic active gastritis with H.pylori and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (+) H.pylori 3","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":122,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":122,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":572},{"_id":573,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_5_8.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":34,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-4","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":401,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":401,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":573},{"_id":574,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_4_1.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":55,"ir_max_age":null,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori Subject 2-1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":null,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori ","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":null,"subject_id":"Gastritis (-) H.pylori Subject 2","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":534,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":null,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":534,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":574},{"_id":575,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_6_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":87,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"MALT-L 2-1","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"MALT-L. S\/P treatment for MALT-L gastric erosion. Histology:lymphoma","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"MALT-L 2","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":151,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":151,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":575},{"_id":576,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_1_1.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":63,"ir_max_age":66,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":66,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, chronis active gastritis with numerous plasma cells, H.pylori positive","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (+) H.pylori 2","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":706,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":66,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":706,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":576},{"_id":577,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_6_4.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":20,"ir_max_age":89,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 5","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":89,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Biopsy from gastric mass smooth muscle infiltrated by a predominantly large B cell lymphoma with numerous mitoses. Profile rating cell nuclear antigen is positive in 80-90% of the tumor cells","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"DLBCL 5","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":777,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":89,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":777,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":577},{"_id":578,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_5_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":39,"ir_max_age":50,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":50,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , Gastric ulcer, chronic active gastritis","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (-) H.pylori 3","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":159,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":50,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":159,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":578},{"_id":579,"pub_ids":"PMC4042156","quality_thresholds":null,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":90,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"MALT-L 3-1","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"MALT-L, stomach lymphoma involving the mucosa and submucosa. The surface epithelium is ulcerated. Histology:MATL-L","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"MALT-L 3","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":null,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":579},{"_id":580,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_4_4.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":85,"ir_max_age":48,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN9","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":48,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"LN9","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":1150,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":48,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":1150,"collection_time_point_relative":"one","tissue":"Right Inguinal lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":580},{"_id":581,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_5_1.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":70,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 3-2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, Chronic active gastritis with H.pylori and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (+) H.pylori 3","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":253,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":253,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":581},{"_id":582,"pub_ids":"PMC4042156","quality_thresholds":null,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":28,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":null,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":582},{"_id":583,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_6_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":45,"ir_max_age":36,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":36,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , hiatus hernia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (-) H.pylori 2","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":265,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":36,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":265,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":583},{"_id":585,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_5_2.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":78,"ir_max_age":44,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN8","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":44,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Axillary lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"LN8","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":658,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":44,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":0,"collection_time_point_relative":"one","tissue":"Left axillary lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":585},{"_id":584,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_4_9.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":23,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":23,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":23,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":584},{"_id":586,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_5_9.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":91,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"MALT-L 3-1","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"MALT-L, stomach lymphoma involving the mucosa and submucosa. The surface epithelium is ulcerated. Histology:MATL-L","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"MALT-L 3","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":1,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":1,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":586},{"_id":587,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_1_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":16,"ir_max_age":34,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":34,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Partial gastrectomy-lymphoma, large cell type, and the tumor is limited to the mucosa","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 1","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":195,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":34,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":195,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":587},{"_id":588,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_3_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":43,"ir_max_age":52,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 4","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":52,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , gastric polyps. Focal acute and chronic gastritis and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (-) H.pylori 4","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":187,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":52,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":187,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":588},{"_id":590,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_3_2.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":75,"ir_max_age":54,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN10","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":54,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Axillary lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"LN10","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":533,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":54,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":533,"collection_time_point_relative":"one","tissue":"Right Axillary Lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":590},{"_id":589,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_5_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":12,"ir_max_age":61,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":61,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach localized large cell lymphoma with ulceration and associated severe chronic and acute inflammation, fibrosis and peritonitis","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"DLBCL 3","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":268,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":61,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":268,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":589},{"_id":591,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"N A","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":15,"ir_max_age":34,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":34,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Partial gastrectomy-lymphoma, large cell type, and the tumor is limited to the mucosa","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 1","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":34,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":0,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":591},{"_id":592,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_6_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":44,"ir_max_age":36,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":36,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , hiatus hernia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (-) H.pylori 2","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":187,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":36,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":187,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":592},{"_id":593,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_5_9.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":89,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"MALT-L 3-1","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"MALT-L, stomach lymphoma involving the mucosa and submucosa. The surface epithelium is ulcerated. Histology:MATL-L","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"MALT-L 3","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":1,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":1,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":593},{"_id":594,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_2_2.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":49,"ir_max_age":65,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 5","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":65,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori, nodular gastric mucosa. Chronic gastritis and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (-) H.pylori 5","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":979,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":65,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":979,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":594},{"_id":595,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_5_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":40,"ir_max_age":50,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":50,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , Gastric ulcer, chronic active gastritis","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (-) H.pylori 3","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":179,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":50,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":179,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":595},{"_id":596,"pub_ids":"PMC4042156","quality_thresholds":null,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":51,"ir_max_age":null,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori Subject 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":null,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori ","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":null,"subject_id":"Gastritis (-) H.pylori Subject 1","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":null,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":null,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":596},{"_id":597,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_6_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":46,"ir_max_age":36,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":36,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , hiatus hernia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (-) H.pylori 2","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":241,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":36,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":241,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":597},{"_id":598,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_6_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":65,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 3-1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, Chronic active gastritis with H.pylori and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (+) H.pylori 3","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":750,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":750,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":598},{"_id":599,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_4_1.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":53,"ir_max_age":null,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori Subject 2-1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":null,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori ","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":null,"subject_id":"Gastritis (-) H.pylori Subject 2","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":253,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":null,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":253,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":599},{"_id":600,"pub_ids":"PMC4042156","quality_thresholds":null,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":27,"ir_max_age":75,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 4-2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":75,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"DLBCL. Stomach (partial gastrectomy) large B cell lymphoma with follicular areas involving the mucosa and submucosa. The surface epithelium is ulcerated. Surgical edges are free of tumor","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"DLBCL 4","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":75,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":null,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":600},{"_id":601,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_4_4.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":83,"ir_max_age":48,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN9","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":48,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"LN9","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":732,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":48,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":732,"collection_time_point_relative":"one","tissue":"Right Inguinal lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":601},{"_id":602,"pub_ids":"PMC4042156","quality_thresholds":null,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":null,"race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":21,"ir_max_age":89,"library_source":"Genomic","data_processing_protocols":"All samples were pooled and barcodes split them apart --- No samples made it through the filtering process","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"DLBCL 5","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":89,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Biopsy from gastric mass smooth muscle infiltrated by a predominantly large B cell lymphoma with numerous mitoses. Profile rating cell nuclear antigen is positive in 80-90% of the tumor cells","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"DLBCL 5","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":0,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":89,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphoma","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":null,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":602},{"_id":603,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_2_2.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":47,"ir_max_age":65,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 5","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":65,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori, nodular gastric mucosa. Chronic gastritis and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (-) H.pylori 5","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":547,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":65,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":547,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":603},{"_id":604,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_2_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":80,"ir_max_age":63,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN11","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":63,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"fever of unknown origin, lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"LN11","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":442,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":63,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":442,"collection_time_point_relative":"one","tissue":"Left axillary lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":604},{"_id":605,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_2_6.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":37,"ir_max_age":30,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":30,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (-) H.pylori 1","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":56,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":30,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":56,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":605},{"_id":606,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_5_2.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":77,"ir_max_age":44,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN8","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":44,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Axillary lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"LN8","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":257,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":44,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":257,"collection_time_point_relative":"one","tissue":"Left axillary lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":606},{"_id":607,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_5_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":72,"ir_max_age":68,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (+) H.pylori 3-3","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":68,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (+) H.pylori, Chronic active gastritis with H.pylori and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"Gastritis (+) H.pylori 3","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":217,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":68,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":217,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":607},{"_id":608,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873442_2_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":82,"ir_max_age":63,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Case","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"LN11","medical_history":null,"sample_type":null,"complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":63,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"fever of unknown origin, lymphadenopathy","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"M","subject_id":"LN11","cell_number":"24,201","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":850,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":63,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Lymphodenopathy","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":850,"collection_time_point_relative":"one","tissue":"Left axillary lymph node","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":608},{"_id":610,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_1_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":50,"ir_max_age":null,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori Subject 1","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":null,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori ","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":null,"subject_id":"Gastritis (-) H.pylori Subject 1","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":755,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":null,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":755,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":610},{"_id":609,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873441_3_5.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":42,"ir_max_age":52,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori 4","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":52,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori , gastric polyps. Focal acute and chronic gastritis and intestinal metaplasia","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":"F","subject_id":"Gastritis (-) H.pylori 4","cell_number":"19,927","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":"sample collection","physical_linkage":null,"ir_sequence_count":103,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":52,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":103,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":609},{"_id":611,"pub_ids":"PMC4042156","quality_thresholds":25,"cell_processing_protocol":null,"collection_time_point_reference":null,"imgt_file_name":"SRR873440_4_3.txz","race":null,"linked_subjects":null,"template_class":"DNA","ir_record_number":56,"ir_max_age":null,"library_source":"Genomic","data_processing_protocols":"Lost many sequences to not being able to de-multiplex with 100% confidence --- All samples were pooled and barcodes split them apart --- Barcodes and primers removed and igblast and imgt annotation of quality filtered sequences","cell_storage":null,"pcr_target_locus":null,"study_group_description":"Control","read_length":null,"inclusion_exclusion_criteria":null,"anatomic_site":null,"cell_isolation":null,"template_amount":null,"study_title":"Immunoglobulin gene repertoire diversification and selection in the stomach - from gastritis to gastric lymphomas","template_quality":null,"cell_subset":"B cell","grants":null,"cell_quality":null,"disease_length":null,"sample_id":"Gastritis (-) H.pylori Subject 2-2","medical_history":null,"sample_type":"Gastric biopsy","complete_sequences":null,"sequencing_kit":null,"library_construction_method":"PCR","study_description":"Cancer Study","ir_min_age":null,"library_generation_kit_version":null,"lab_name":"Ramit Mehr's Computational Immunology Lab","prior_therapies":null,"disease_diagnosis":"Gastritis (-) H.pylori ","cells_per_reaction":"10^9 PCR molecules","primer_match_cutoffs":null,"library_generation_protocol":null,"sequencing_run_date":null,"synthetic":null,"sex":null,"subject_id":"Gastritis (-) H.pylori Subject 2","cell_number":"14,996","ethnicity":null,"link_type":null,"ancestry_population":null,"reverse_pcr_primer_target_location":"JH1 and then JH2","lab_address":"Bar Iian University","cell_phenotype":"stained with CD20, CD3, CD23, CD21, cyclin D1, Ki67, IgD","age_event":null,"physical_linkage":null,"ir_sequence_count":314,"strain_name":null,"collapsing_method":null,"sequencing_facility":null,"sequencing_run_id":null,"age":null,"immunogen":null,"single_cell":null,"collected_by":"ramit.mehr@biu.ac.il","disease_state_sample":"Gastritis","tissue_processing":null,"forward_pcr_primer_target_location":"FR2 ","study_id":"PRJNA206548","sequencing_platform":"454 GS FLX Titanium","organism":"Homo sapiens","submitted_by":"M. Michaeli, H. Tabibian-Keissar, I. Barshack, R. Mehr, ","disease_stage":null,"intervention":null,"biomaterial_provider":null,"software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","total_reads_passing_qc_filter":314,"collection_time_point_relative":"one","tissue":"Stomach epithelium","paired_read_assembly":null,"germline_database":null,"ir_project_sample_id":611},{"_id":612,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":609,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500422","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"1,558,750","mixcr_file_name":"SRR3500422_mixcr.vdjca, SRR3500422_annotation.txt, SRR3500422.clns, SRR3500422_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500422_a.txz, SRR3500422_b.txz, SRR3500422_c.txz, SRR3500422_d.txz","Paired_read_assembly":"pear -f SRR3500422_filtered_1.fastq -r SRR3500422_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500422.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500422.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":1556558,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"p18","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"p18 PBL","ir_sra_run_id":"SRR3500422","cell_subset":"TCR","ir_project_sample_id":612},{"_id":613,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":606,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500419","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"2,040,754","mixcr_file_name":"SRR3500419_mixcr.vdjca, SRR3500419_annotation.txt, SRR3500419.clns, SRR3500419_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500419_a.txz, SRR3500419_b.txz, SRR3500419_c.txz, SRR3500419_d.txz, SRR3500419_e.txz","Paired_read_assembly":"pear -f SRR3500419_filtered_1.fastq -r SRR3500419_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500419.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500419.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":2029652,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"p6","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"p6 tumor PBL","ir_sra_run_id":"SRR3500419","cell_subset":"TCR","ir_project_sample_id":613},{"_id":614,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":604,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500417","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"1,127,474","mixcr_file_name":"SRR3500417_mixcr.vdjca, SRR3500417_annotation.txt, SRR3500417.clns, SRR3500417_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500417_a.txz, SRR3500417_b.txz, SRR3500417_c.txz","Paired_read_assembly":"pear -f SRR3500417_filtered_1.fastq -r SRR3500417_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500417.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500417.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":1123860,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"p16","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"p16 tumor","ir_sra_run_id":"SRR3500417","cell_subset":"TCR","ir_project_sample_id":614},{"_id":615,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":613,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500426","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"2,259,202","mixcr_file_name":"SRR3500426_mixcr.vdjca, SRR3500426_annotation.txt, SRR3500426.clns, SRR3500426_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500426_a.txz, SRR3500426_b.txz, SRR3500426_c.txz, SRR3500426_d.txz, SRR3500426_e.txz","Paired_read_assembly":"pear -f SRR3500426_filtered_1.fastq -r SRR3500426_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500426.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500426.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":2258741,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"p19","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"p19 tumor","ir_sra_run_id":"SRR3500426","cell_subset":"TCR","ir_project_sample_id":615},{"_id":616,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":624,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500437","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"2,006,868","mixcr_file_name":"SRR3500437_mixcr.vdjca, SRR3500437_annotation.txt, SRR3500437.clns, SRR3500437_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500437_a.txz, SRR3500437_b.txz, SRR3500437_c.txz, SRR3500437_d.txz, SRR3500437_e.txz","Paired_read_assembly":"pear -f SRR3500437_filtered_1.fastq -r SRR3500437_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500437.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500437.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":1941308,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"p8","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"p8 tumor","ir_sra_run_id":"SRR3500437","cell_subset":"TCR","ir_project_sample_id":616},{"_id":617,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":621,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500434","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"2,058,553","mixcr_file_name":"SRR3500434_mixcr.vdjca, SRR3500434_annotation.txt, SRR3500434.clns, SRR3500434_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500434_a.txz, SRR3500434_b.txz, SRR3500434_c.txz, SRR3500434_d.txz, SRR3500434_e.txz","Paired_read_assembly":"pear -f SRR3500434_filtered_1.fastq -r SRR3500434_filtered_2.fastq -n 150 -t 150 -q 34 -o paired_SRR3500434.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500434.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":2056660,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"p20","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"p20 tumor RL LN RL","ir_sra_run_id":"SRR3500434","cell_subset":"TCR","ir_project_sample_id":617},{"_id":618,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":610,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500423","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"1,880,722","mixcr_file_name":"SRR3500423_mixcr.vdjca, SRR3500423_annotation.txt, SRR3500423.clns, SRR3500423_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500423_a.txz, SRR3500423_b.txz, SRR3500423_c.txz, SRR3500423_d.txz","Paired_read_assembly":"pear -f SRR3500423_filtered_1.fastq -r SRR3500423_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500423.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500423.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":1879357,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"p19","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"p19 PBL LN","ir_sra_run_id":"SRR3500423","cell_subset":"TCR","ir_project_sample_id":618},{"_id":619,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":614,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500427","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"294,864","mixcr_file_name":"SRR3500427_mixcr.vdjca, SRR3500427_annotation.txt, SRR3500427.clns, SRR3500427_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500427.txz","Paired_read_assembly":"pear -f SRR3500427_filtered_1.fastq -r SRR3500427_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500427.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500427.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":293498,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"p5","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"p5 PBL LN","ir_sra_run_id":"SRR3500427","cell_subset":"TCR","ir_project_sample_id":619},{"_id":620,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":617,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500430","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"1,124,288","mixcr_file_name":"SRR3500430_mixcr.vdjca, SRR3500430_annotation.txt, SRR3500430.clns, SRR3500430_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500430_a.txz, SRR3500430_b.txz, SRR3500430_c.txz","Paired_read_assembly":"pear -f SRR3500430_filtered_1.fastq -r SRR3500430_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500430.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500430.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":1119489,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"p14","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"p14 PBL","ir_sra_run_id":"SRR3500430","cell_subset":"TCR","ir_project_sample_id":620},{"_id":621,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":608,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500421","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"3,559,226","mixcr_file_name":"SRR3500421_mixcr.vdjca, SRR3500421_annotation.txt, SRR3500421.clns, SRR3500421_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500421_a.txz, SRR3500421_b.txz, SRR3500421_c.txz, SRR3500421_d.txz, SRR3500421_e.txz, SRR3500421_f.txz, SRR3500421_g.txz, SRR3500421_h.txz, ","Paired_read_assembly":"pear -f SRR3500421_filtered_1.fastq -r SRR3500421_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500421.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"SRX1758452","spot_descriptor":null,"adapter_sequence_forward ":null,"experiment_name":"GSE81313: Homo sapiens","fasta_file_name":"SRR3500421.fasta","quality_thresholds":30,"user_tissue":null,"ancestry_population":null,"igblast_file_name":null,"year":2016,"complete_sequences":null,"disease_diagnosis":"Breast Cancer Stage IIIA","sequencing_kit":null,"age_event":"Sample collection","target_locus_for_pcr":"CDR3","lab_name":"Department of Immunology and Microbiology","ir_sequence_count":2327495,"gene_derivation_heavy":null,"age":null,"disease_stage":"Stage IIIA","ir_min_age":null,"inclusion_exclusion_criteria":"Inclusion breast cancer","study_description":"Cancer Study","cell_type":"TCR","reverse_pcr_primer_target_location":"C region","collapsing_method":null,"race":null,"forward_pcr_primer_target_location":"V gene","study_title":"Identification of shared TCR sequences from T cells in human breast cancer using emulsion RT-PCR","study_id":"PRJNA321261 ","lab_address":"Department of Immunology and Microbiology, University of Colorado School of Medicine, Aurora, CO, 80045","subject_id":"c6","disease_state_sample":"Breast cancer","collection_time_point_relative":"one","collection_time_point_reference":"post-surgery","cell_phenotype":"ER+\/PR+","cell_number":null,"submitted_by":"D. J. Munson, C.A. Egelston, J.E. Slansky","cells_per_reaction":null,"template_class":"cDNA","template_quality":30,"template_amount":null,"sample_id":"c6 PBL","ir_sra_run_id":"SRR3500421","cell_subset":"TCR","ir_project_sample_id":621},{"_id":622,"ethnicity":null,"cell_processing_protocol":null,"intervention":null,"bioproject_biosample_id":"SAMN04978743","link_type":null,"disease_length":null,"immunogen":null,"biomaterial_provider":null,"receptor_type":"TCR","ir_record_number":605,"physical_linkage":null,"primer_match_cutoffs":null,"tissue":"Breast tumor tissue","cell_storage":null,"ir_max_age":null,"cell_isolation":null,"onto_tissue":"Breast epithelium","data_processing_protocols":"primers previously removed ---- Sequences filtered and annotated using mixcr and imgt","sequencing_facility":null,"heavy_or_light_chain":"Heavy","study_group_description":"Case","prior_therapies":null,"cell_quality":null,"sample_name":"p1 Tumor","medical_history":null,"single_or_paired":"paired","regions_included_in_sequence":"CDR3","sra_sample_id":"SRS1434669","linked_subjects":null,"sequencing_run_date":null,"pub_ids":"pubmed\/27307436","anatomic_site":"Breast","accession":"SRR3500418","adapter_sequence_reverse":null,"grants":"Department of Defense Congressionally Directed Medical Research Programs Multi-Team Awards BC100597, BC100597P1, and 100597P2, University of Colorado Cancer Center Flow Cytometry Shared Resource Cancer Center Support Grant CA046934","Sequencing_method":"Illumina MiSeq","total_reads_passing_qc_filter":"875,784","mixcr_file_name":"SRR3500418_mixcr.vdjca, SRR3500418_annotation.txt, SRR3500418.clns, SRR3500418_clones.txt","organism":"Homo sapiens","reverse_primers":"GACAGCTCTCGCTTATACCTTC CAAATTTCACTCTGAAGATCCGGTCC CTCACTTAAATCTTCACATCAATTC CCTTCACCTACACGCCCTGC TCCTTCACCTACACACCCTGC GCTCTGAGATGAATGTGAGCAC GCTCTGAGATGAATGTGAGTGC GCTCTGAGCTGAATGTGAACGC TCGCTCAGGCTGGAGTCGGC GCTGGGGTTGGAGTCGGCTG CCTCACGTTGGCGTCTGCTG GCTCAGGCTGCTGTCGGCTG GCTCAGGCTGGAGTTGGCTG CCCTCAAGCTGGAGTCAGCTG ACTCAGGCTGGTGTCGGCTG GCTCAGGCTGGAGTCAGCTG CACTCTGAAGTTCCAGCGCAC CACTCTGACGATCCAGCGCAC ACTCTGAAGATCCAGCGCACAG ACTCTGAAGATCCAGCGCACAG CACTCTGACGATCCAGCGCAC CACTCTGACGATTCAGCGCAC CACTCTGAAGATCCAGCGCAC CACCTTGGAGATCCAGCGCAC GCACTCTGAACTAAACCTGAGC CCCTCACTCTGGAGTCTGCTG CCCTCACTCTGGAGTCAGCTA CTCCTCACTCTGGAGTCCGC CACTCTCAAGATCCAGCCTGCA CACTCTGAAGATCCAGCCCTC CATTCTGAACTGAACATGAGCTCC CTACTCTGAAGGTGCAGCCTG GATAACTTCCAATCCAGGAGGC GCCTTGAGATCCAGGCTACGA CTTCCACGCTGAAGATCCATCC GCATCCTGAGGATCCAGCAGG CCTCTCACTGTGACATCGGCC CCACTCTGACAGTGACCAGTG CAGCCTGGCAATCCTGTCCTC CTCCCTGTCCCTAGAGTCTGC CCCTGACCCTGGAGTCTGCC CCTGATCCTGGAGTCGCCCA CTCCCTGATTCTGGAGTCCGC CTAACATTCTCAACTCTGACTGTG CAGTTCATCCTGAGTTCTAAGAAG","barcode_2":null,"strain_name":null,"imgt_file_name":"SRR3500418_a.txz, SRR3500418_b.txz","Paired_read_assembly":"pear -f SRR3500418_filtered_1.fastq -r SRR3500418_filtered_2.fastq -n 150 -t 150 -q 30 -o paired_SRR3500418.fastq","forward_primers":"AGGAGCTCCAGATGAAAGACTC GCTCATCCTCCAGGTGCGGGAG CCTCCTTCCACCTGAAGAAACC CCTGAGCGACACTGCTGTGTAC CTGTCTCTGCGCATTGCAGACA GACTGAAGGTCACCTTTGATACC GCCGTGCAGCCTGAAGATTCA CCTGTGATTTCCTATGCCTGTC CCTGTGATTTCCTATGCCTGTC TCCTTTAATCTGAGGAAACCCTC GAATTTAAGAGGAGTCAATCTTCC CATCAGAGGTTTTGAGGCTGAAT CATCAACGGTTTTGAGGCTGAAT GAAACCACTTCTTTCCACTTGGA CTGCACATCACAGCCTCCCAG GAATATCGCAGCCTCTCATCTG CAGTGATTCAGCCACCTACCTC GACAGCCAAACATTTCTCCCTG GACAGTGAAACATCTCTCTCTGC CCAACCTTGTCATCTCCGCTTC GAATATGCTGGTCTCTCATCCTG CCATTTGCTCAAGAGGAAGACTC CTTGTTGATCACGGCTTCCCG AGAAGCCCTCGGTGCAGCTG CCACCAGTTCCTTCAACTTCAC CACATCACAGCCCCTAAACCTG CATCAGGACGTAGTACTTTATACA GTACATTTCCTCTTCCCAGACC GCAGTTCTCATTGCATATCATGG ATCAAAGGATCCCAGCCTGAAG GCACATCACAGCCACCCAGAC AGTCCAGCACCTTGATCCTGC ACAGAAAGTCCAGTACCTTGATC AGGACAGTTCTCTCCACATCAC CTATACATCAGATTCCCAGCCTG GAGACTCTGCAGTGTACTTCTG GCAAAGCTCCCTGTACCTTACG GCTTATCATATCATCATCACAGCC CCCAACCAGGAGACTCATTCC TCCTTAAAACTGACTCAGCCAAG GCAAAGTTCCCTGCATATCACAG AGCTTCCTGAATATCTCAGCATC CAGCATCCTGAACATCACAGCC","sequencing_run_id":null,"tissue_processing":"Separated tumor from fat tissue and minced into pieces up to 2mm in diameter with a scalpel, Fragments treated with 0.2 Wunsch u\/mL Liberase, 10 u\/mL DNase up to 1 hour until tissue dissociated, Digested tissue suspension filtered through a 70 micrometer filter followed by a 40 micrometer filter","single_cell":"Yes","collected_by":"kapplerj@njhealth.org jill.slanksy@ucdenver.edu","library_name":null,"sample_type":"Tumour tissue and PBLs","sex":"F","read_length":"250bp","library_source":"Transcriptomic","gene_derivation_light":null,"antigen ":null,"protocol_id":null,"Software_versions":"SRA Toolkit 2.8.2-1, cutadapt 1.14, fastqc 0.11.5, pear 0.9.10, biopython 2.7.13, igblast 1.8.0","barcode_1":null,"germline_database":"IMGT","library_generation_protocol":"RT-PCR","synthetic":"no","experiment_id":"S